ID: 907863035

View in Genome Browser
Species Human (GRCh38)
Location 1:58372148-58372170
Sequence CAGGCAATGAAAGCAGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 3, 2: 39, 3: 134, 4: 519}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907863031_907863035 -6 Left 907863031 1:58372131-58372153 CCACAGGCACCCAACGCCAGGCA 0: 1
1: 0
2: 3
3: 85
4: 904
Right 907863035 1:58372148-58372170 CAGGCAATGAAAGCAGCTGCAGG 0: 1
1: 3
2: 39
3: 134
4: 519
907863028_907863035 11 Left 907863028 1:58372114-58372136 CCAGGCACTTGGAAAAACCACAG 0: 1
1: 0
2: 33
3: 425
4: 887
Right 907863035 1:58372148-58372170 CAGGCAATGAAAGCAGCTGCAGG 0: 1
1: 3
2: 39
3: 134
4: 519
907863026_907863035 27 Left 907863026 1:58372098-58372120 CCACTGACAGCTTGCGCCAGGCA 0: 1
1: 5
2: 182
3: 438
4: 1039
Right 907863035 1:58372148-58372170 CAGGCAATGAAAGCAGCTGCAGG 0: 1
1: 3
2: 39
3: 134
4: 519

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907863035 Original CRISPR CAGGCAATGAAAGCAGCTGC AGG Intronic
900492086 1:2955391-2955413 CAACCCATGAAAGCAGCTGGTGG - Intergenic
900571812 1:3362361-3362383 CAGGCAATCAAAGCAGACTCGGG + Intronic
900808169 1:4781473-4781495 CATGCTATGCATGCAGCTGCTGG + Intronic
901461207 1:9392877-9392899 CAGGAAATGACAGCACCTTCGGG + Intergenic
902750567 1:18506695-18506717 CAAGGAATGAAGGCAGCTTCTGG - Intergenic
905599929 1:39240975-39240997 CAGGGAATAAAAGTAGCAGCTGG - Intronic
906353682 1:45084806-45084828 CAGCCCTTGAAAGCAGCTGTGGG - Intronic
907281303 1:53349043-53349065 GAGGCAGAGAACGCAGCTGCAGG + Intergenic
907315474 1:53568088-53568110 CAGCTCATGAAAGCAGCCGCGGG + Intronic
907687220 1:56623731-56623753 CAGCTCATGAAAGCTGCTGCAGG + Intronic
907808074 1:57841278-57841300 CAGCCCATGAAAGCAGCTGCAGG - Intronic
907863035 1:58372148-58372170 CAGGCAATGAAAGCAGCTGCAGG + Intronic
908879087 1:68710432-68710454 CAGCCTGTGAAAGCAGCTGCAGG + Intergenic
909713417 1:78678275-78678297 CAGAAAATGAAAGCAACTCCGGG + Intergenic
910537771 1:88318950-88318972 CACACAATGAAACCAGCTGTGGG - Intergenic
911277434 1:95879292-95879314 CAGGCCATGAAAGCAGCTGCAGG - Intergenic
911302590 1:96193089-96193111 CAGCCCATGAAAGCAGCAGTGGG + Intergenic
911983431 1:104594380-104594402 CAGCCCTTGAAAGCAGCTGTGGG + Intergenic
912861103 1:113214695-113214717 CAGCCTGTGAGAGCAGCTGCAGG - Intergenic
913291322 1:117274838-117274860 CCTGCAGTGAAAGCAGCTGAAGG + Intergenic
915058390 1:153158507-153158529 CAGCTCAAGAAAGCAGCTGCAGG - Intergenic
915281092 1:154822677-154822699 CAGGAGATGAGAGCAGCTGCCGG - Intronic
916829296 1:168474719-168474741 CAACCCATGAAAGCAGCTGCAGG + Intergenic
918667700 1:187172287-187172309 CAGGAAGTGACAGCTGCTGCAGG - Intergenic
918809256 1:189094279-189094301 AAGGCAAAGACAGAAGCTGCTGG + Intergenic
919006728 1:191908686-191908708 CAGCCCATGAAAGCAGGTGCAGG - Intergenic
919044264 1:192431060-192431082 CAGCCAGTGAAGGCAACTGCAGG + Intergenic
919179182 1:194059345-194059367 CAGCCCATGAAAGCAGCTGCAGG - Intergenic
919212896 1:194510883-194510905 CAGCCTGTGAAAGCAGCTGTAGG + Intergenic
919273784 1:195385476-195385498 CAGCCCATGAAAGCAGCCACAGG + Intergenic
919302254 1:195785592-195785614 CAGGCAAAGAGAGCAAGTGCAGG - Intergenic
919311709 1:195917758-195917780 CAGCTCATGAAAGAAGCTGCAGG + Intergenic
919750712 1:201036307-201036329 GAGACAATGTAAGCAGCTGTGGG + Intergenic
919827196 1:201511686-201511708 CAGGGACTGAAAGCAAATGCTGG - Intergenic
920963313 1:210682685-210682707 AAGGCCAGAAAAGCAGCTGCAGG - Exonic
921013786 1:211168777-211168799 CATCCCATGAAAGCAGCTGCAGG - Intergenic
921518147 1:216123354-216123376 CAGGCAATCAATGCATTTGCTGG + Intronic
922530710 1:226342839-226342861 CAGGCAAAGAAAGCTTCTGCAGG - Intergenic
922667736 1:227487327-227487349 CAGCCTGTGAAAGCAGCTGAGGG - Intergenic
922864599 1:228848720-228848742 TTGGCCATGAAAGCAGCTGTAGG - Intergenic
923339297 1:232994201-232994223 CAGCCCATGAAAACAGCTGCAGG + Intronic
1062765197 10:57192-57214 CAGCCCATGAGAGCAGCTGTGGG - Intergenic
1062770447 10:96218-96240 CAGCCCATGAAAGCAGCTGCAGG - Intergenic
1064757782 10:18587671-18587693 CAGGAAGTGCAAGCAGCTGGGGG + Intronic
1065469588 10:26063957-26063979 CAGGCACTGTTAACAGCTGCTGG + Intronic
1066043518 10:31577096-31577118 CAGGCAAATAATGCAGCTGATGG + Intergenic
1068252130 10:54456231-54456253 CAGCCTGTGAAAGCAGCTGAAGG + Intronic
1068449294 10:57165353-57165375 CAGCCCATGAAAGCAGCTGTAGG - Intergenic
1068533480 10:58214281-58214303 GAGGGAATAAAAGCAACTGCAGG + Intronic
1068604532 10:58990546-58990568 TAGCCCGTGAAAGCAGCTGCAGG + Intergenic
1068696652 10:59974980-59975002 CAAGCCATGAAAGCACATGCAGG - Intergenic
1069202533 10:65639324-65639346 CAGGCAAAGGAAGCAACTGAAGG + Intergenic
1070167077 10:73906920-73906942 CAGGCACTGAAAGCCGCTTCTGG - Intergenic
1071200308 10:83214525-83214547 CGGGAAATGAAAGCAGCAGAAGG + Intergenic
1073922077 10:108470713-108470735 CAGTCTATGAAAGCAGCAGTAGG - Intergenic
1074405975 10:113180779-113180801 CGGGTAAAGAAAGAAGCTGCTGG + Intergenic
1074771355 10:116736624-116736646 GTGGCAATGAAAGCAGGGGCTGG + Intronic
1076086167 10:127634215-127634237 CAGCCCAGAAAAGCAGCTGCAGG - Intergenic
1077075314 11:698532-698554 CAGACAATGAGAGCAGCTGTTGG + Intronic
1077133129 11:984609-984631 CAGGCAATGAGACACGCTGCCGG - Intronic
1077740788 11:4843113-4843135 CAGCCTGTGAAAGCAACTGCAGG - Intronic
1078393443 11:10956436-10956458 CAGCCCATTAAAGCAGCTACAGG + Intergenic
1078743793 11:14091938-14091960 CAGGAAGTGCAAGCAGCTGGGGG - Intronic
1078750155 11:14154064-14154086 CAGTCTGTGAAAACAGCTGCAGG - Intronic
1078978647 11:16506167-16506189 CAGTCCATCAAAGCAGCTACAGG + Intronic
1079707336 11:23637410-23637432 CAGCCTATGAAAGCAGCTGCAGG - Intergenic
1079952632 11:26823671-26823693 CAGCCTGTGAAAGCAGCTGCAGG - Intergenic
1079974454 11:27074905-27074927 CAGCCTGTGAAAGCAGCTACAGG - Intronic
1080045001 11:27799257-27799279 CAGCCCACGAGAGCAGCTGCAGG + Intergenic
1080461634 11:32459781-32459803 CTGGCATTTAAAGCATCTGCAGG + Intergenic
1081730634 11:45369591-45369613 CAGACACTGAAAACAGCTGCTGG + Intergenic
1082692648 11:56324872-56324894 CAGTCCATGAAAGCAGCTGCAGG + Intergenic
1083596398 11:63919947-63919969 CAGGCAAGGGATGCAGCTTCTGG - Intergenic
1084248016 11:67873409-67873431 CAGGCGATGGCAGCAGCAGCTGG + Intergenic
1084498636 11:69521085-69521107 CAGCCCATGAAAGCAGCTGTGGG - Intergenic
1084512260 11:69613523-69613545 CATGCAATAAAGGCAGCAGCAGG + Intergenic
1084609425 11:70192863-70192885 CAGGCCAAGGCAGCAGCTGCTGG + Intergenic
1084798545 11:71526009-71526031 CAACCCATGAGAGCAGCTGCAGG + Intergenic
1084803641 11:71564270-71564292 CAACCCATGAGAGCAGCTGCAGG + Intronic
1085000385 11:73028203-73028225 CAGCCTGTGAAAGTAGCTGCAGG + Intronic
1085324332 11:75595131-75595153 CAGGCAGTGCGAGCAGCGGCTGG - Intronic
1085818897 11:79771030-79771052 CAGCCCATGAAAGCAGCTACAGG + Intergenic
1086072460 11:82814289-82814311 CACCTAATGAAAGCAGGTGCCGG + Intergenic
1086377526 11:86216089-86216111 CAGGAAATGAAACCAACTTCTGG + Intergenic
1086942139 11:92809332-92809354 CAGGTAATGAAAACAGAAGCTGG - Intronic
1087065363 11:94022856-94022878 CAGTCAATGTGAGCAGCTACTGG + Intronic
1087336638 11:96852160-96852182 CAGCCCATGAAAGCAGCCACAGG + Intergenic
1088376702 11:109149105-109149127 CAAGCAATAAAAACAGATGCAGG + Intergenic
1088388769 11:109290476-109290498 CAGCCTGTGAAAGCAGTTGCAGG - Intergenic
1089949933 11:122516138-122516160 CAGGCAAAGAAACCAAGTGCTGG + Intergenic
1090099051 11:123774527-123774549 CAGGCAAAGAAAGCTTGTGCAGG + Intergenic
1090595316 11:128314845-128314867 CAGCCAATGAAAGAAGCCACTGG - Intergenic
1091184821 11:133637699-133637721 CAGGCAGGAAAAGCAGGTGCAGG - Intergenic
1091254648 11:134173018-134173040 CAGGCAGTGCAAGGACCTGCAGG + Intronic
1092944258 12:13438607-13438629 CAGCCCATGAAAGCAGCTGCAGG - Intergenic
1093051595 12:14510840-14510862 AAAGCACTCAAAGCAGCTGCAGG - Intronic
1093350963 12:18102959-18102981 CAGCCTGTGAAAGCAGTTGCAGG - Intronic
1093505775 12:19864505-19864527 CAGGCAAAGGAAGGATCTGCAGG - Intergenic
1093570759 12:20663427-20663449 CAGCCTGTGAAAGCAGCTGGAGG + Intronic
1093669314 12:21853825-21853847 CAGGGAATGAAAGAAACTGAGGG + Intronic
1093958761 12:25250787-25250809 CAGGCACTGAAGGCGGCGGCGGG - Exonic
1093988971 12:25569112-25569134 CAACCCATGAAGGCAGCTGCAGG + Intronic
1094219504 12:27976360-27976382 CACTCAATGAAAGCAGGTGTTGG - Intergenic
1095101586 12:38190572-38190594 CAGTCCATGAGAGCAGCTGTGGG + Intergenic
1095516898 12:43016031-43016053 CACTCAATGAAAGCAGCCACAGG + Intergenic
1095965675 12:47865348-47865370 CAGGCAATGAAAGGAGAAGTAGG - Intronic
1097302713 12:58035537-58035559 CAGCCTGTGAAAGCAGCTACAGG - Intergenic
1097709718 12:62904633-62904655 CAGGCAATGAAAGTAAAGGCAGG + Intronic
1098180307 12:67840197-67840219 CAGACAACGCAAGCAGGTGCTGG + Intergenic
1098253448 12:68592254-68592276 CAACCTATGAGAGCAGCTGCGGG - Intergenic
1098319883 12:69232446-69232468 CAGCCCATGAAAGCAGCCACAGG + Intergenic
1098649880 12:72951935-72951957 CAGCCCATGAAAGCAGCCGGTGG - Intergenic
1098771545 12:74559428-74559450 CAGCCCATGAAAGCAGCTGTAGG - Intergenic
1099907513 12:88789976-88789998 CAGCCTGTGAAAGCAGCTGAAGG - Intergenic
1100028790 12:90161578-90161600 CAGTCTGTGAAAGCAGCTGCAGG - Intergenic
1100072189 12:90734707-90734729 TAGCCCATGAAAGCAGCTGTGGG - Intergenic
1100164502 12:91901167-91901189 CAGCTCATGAAAGCAGCTGTGGG + Intergenic
1101257911 12:102997928-102997950 CAGCACATGAAAGCAGCTGGGGG - Intergenic
1102775607 12:115516029-115516051 CAGGCAAGGAGAGCTGGTGCAGG + Intergenic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1105257375 13:18753084-18753106 CAGCCCATGAAAGCAGCTGCAGG + Intergenic
1105258712 13:18762917-18762939 CAGCCCATGAGAGCAGCTACAGG + Intergenic
1105260049 13:18772448-18772470 CAGCCCATGAAAGGAGCTGCAGG + Intergenic
1105261381 13:18782220-18782242 CAGCCCATGAGAGCAGCTACAGG + Intergenic
1105262721 13:18791761-18791783 CAGTCCGTGAGAGCAGCTGCAGG + Intergenic
1106387382 13:29301237-29301259 AGGGCAATGAGAGCTGCTGCAGG - Intronic
1106714468 13:32373693-32373715 CAGCCCATGAAAGCAGCTGCAGG - Intronic
1106715529 13:32384279-32384301 ATGGCAATGAGAGCACCTGCAGG + Intronic
1107458357 13:40576525-40576547 CAGCCAAGGACAGCAGCTCCTGG - Intronic
1108699503 13:52931854-52931876 CTTGCATTGAAAGCAGCAGCAGG - Intergenic
1108790734 13:53966596-53966618 CAGTCCATGAAAGCAGCTGGAGG + Intergenic
1109239522 13:59868073-59868095 CAGTCTATGAAAGCCACTGCAGG + Intronic
1109491101 13:63100999-63101021 CAGACTGTGAAAGCAGCTGTGGG + Intergenic
1109906291 13:68846286-68846308 CAGCCTGTGAAAGCAGCTGCAGG + Intergenic
1109962164 13:69645104-69645126 CAGCCCATGACAGGAGCTGCAGG + Intergenic
1110166431 13:72448495-72448517 CAGCCCATGAAAACAGCTGGGGG + Intergenic
1110209329 13:72953683-72953705 CAGGCAATGGCAACAGCTGAGGG + Intronic
1111020199 13:82438701-82438723 CAGCCTGTGAAAGCAGCTGAGGG + Intergenic
1111065792 13:83089538-83089560 CAGCCCACGAAAGAAGCTGCAGG + Intergenic
1111085533 13:83371763-83371785 CAGCCCATGAAAGCAGCCGTGGG - Intergenic
1111097246 13:83532924-83532946 AAGGCAAAGACAGAAGCTGCTGG + Intergenic
1111144849 13:84166721-84166743 CAGCCCATGAAAGCAGCTGCAGG - Intergenic
1111463373 13:88575778-88575800 CAGCCCATGAAAGCAGCACCAGG - Intergenic
1111510489 13:89255464-89255486 CAGGCAAAGAAAGCATGTGCAGG - Intergenic
1111568450 13:90047569-90047591 CAGCCTATGAAAGCAGCTGAGGG - Intergenic
1111641915 13:90980016-90980038 TAGCCCATGAAAGCAGCTACGGG - Intergenic
1111778684 13:92694376-92694398 CAGCCTGTGAAAGCAGCTGCAGG + Intronic
1112742905 13:102495320-102495342 CAGCCCATGAAAGCAGCTACAGG - Intergenic
1112817446 13:103289509-103289531 CAGGCAATGAAAGCAAAAACAGG + Intergenic
1113320592 13:109228710-109228732 CAGCCCATGAAAGCAGCAGTGGG - Intergenic
1113501820 13:110781889-110781911 CAGCTCATGAAAGCAGCTGTGGG - Intergenic
1113600144 13:111562889-111562911 AAGGGGGTGAAAGCAGCTGCAGG + Intergenic
1114433034 14:22678777-22678799 CAGCCGATGAAAGCATCTGCAGG + Intergenic
1114843298 14:26291196-26291218 CCAGCCTTGAAAGCAGCTGCGGG - Intergenic
1115085744 14:29512997-29513019 CAGCCTGTGAAAGCAGCTGGAGG - Intergenic
1115121443 14:29942106-29942128 CAGCCCATAAAAGCAGCTGTCGG + Intronic
1115916505 14:38321145-38321167 CAGCCAATGAGAGCAGCTGTAGG - Intergenic
1115929802 14:38478319-38478341 CAGCCCATGAAAGCAGCTGGAGG + Intergenic
1115939383 14:38591482-38591504 CAGGGAATTGAAGCAGGTGCTGG - Intergenic
1115944469 14:38644070-38644092 CAGCCTGTGAAAGCAGCTGCAGG + Intergenic
1116998348 14:51347288-51347310 CAAGCCGTAAAAGCAGCTGCAGG + Intergenic
1117054302 14:51895879-51895901 CAGGCAAAGAGAGCATGTGCAGG - Intronic
1117209509 14:53481196-53481218 CAGCCCATGAAGGCAGCTCCAGG - Intergenic
1117758284 14:58999040-58999062 CAGGCCATGAAAACAGTTGCAGG + Intergenic
1118119930 14:62829174-62829196 CAGCCCATGAAAGCAGCTATGGG - Intronic
1118338863 14:64878961-64878983 CAGGCTGGGGAAGCAGCTGCGGG - Intronic
1118715414 14:68556364-68556386 CAGACAAGGAGAGCAGCTGGAGG - Intronic
1120343002 14:83245446-83245468 CAGCCTGTGAAAGCAACTGCAGG + Intergenic
1120571015 14:86116564-86116586 CAGCATGTGAAAGCAGCTGCAGG + Intergenic
1120693732 14:87621340-87621362 CAGCTCATGAAAGCAGCTGTGGG - Intergenic
1121087070 14:91154883-91154905 CTGGAAAGGAAAGCAGCGGCTGG - Intronic
1121914183 14:97820945-97820967 CAGCCCATGAAAGCAGCTGCAGG + Intergenic
1121983307 14:98474298-98474320 CAGACAATGTAAGCAGGTTCTGG - Intergenic
1122058597 14:99121767-99121789 CAGGCAGGGAAAGCTGCCGCAGG - Intergenic
1122765441 14:104066331-104066353 CAGGCTGTGAAAGCAGCTGCAGG - Intergenic
1123140584 14:106073505-106073527 CAGCCTATGAAAGCAGCTATGGG + Intergenic
1202834719 14_GL000009v2_random:69233-69255 CAGCCCATGAGAGCAGCAGCAGG - Intergenic
1124445028 15:29722752-29722774 CAGTCCATGAAAGGAGCTGCAGG + Intronic
1125066041 15:35487123-35487145 CAGCCCATGAAAGCAGCTGCAGG - Intronic
1125225314 15:37389363-37389385 TAGCCTGTGAAAGCAGCTGCAGG - Intergenic
1125407617 15:39369900-39369922 CAGCCTGTGAAAGCAGCTGTGGG - Intergenic
1125510848 15:40291605-40291627 GAGGCTATGAAAGAAGCTGCGGG - Exonic
1126929558 15:53632628-53632650 CAGCCCATGAGAGCAGCTGTGGG + Intronic
1127012862 15:54649381-54649403 CAGCCCCTGAAAGCAGCTGCGGG - Intergenic
1127026716 15:54815100-54815122 CAGCCCATGAAACCAGCTACAGG + Intergenic
1127322238 15:57858072-57858094 GGGGCAATGAAAACAGCTGTGGG - Intergenic
1128546513 15:68572193-68572215 CAGTCACTGGCAGCAGCTGCAGG + Intergenic
1128624762 15:69188843-69188865 GAGTCAATGAAAGCAAATGCTGG - Intronic
1128930822 15:71703638-71703660 CAGGCACTGAGTCCAGCTGCAGG + Intronic
1130657311 15:85800725-85800747 CTGGCAGGGACAGCAGCTGCAGG + Intergenic
1130865698 15:87931681-87931703 AAGGAAATGAAAGCATCTGTGGG - Intronic
1131768059 15:95701721-95701743 CAGGCAATGAGAGCTTGTGCAGG + Intergenic
1131987550 15:98060381-98060403 CAGTCCTTGAAAGCAGCTTCAGG - Intergenic
1132140960 15:99394544-99394566 CAGGCAAAGAAAACAACTACAGG + Intergenic
1132902261 16:2263578-2263600 CAGGCTGGGAAGGCAGCTGCTGG + Intronic
1133043036 16:3070708-3070730 CAGCCCATGAAAGCAGCTGCGGG - Intronic
1133045121 16:3083643-3083665 CAGCCCATGAAAGCAGCTGCGGG - Intergenic
1133711219 16:8403096-8403118 CAGTCAATAACAGCTGCTGCTGG + Intergenic
1134471449 16:14529992-14530014 CAGGCCTGGAAACCAGCTGCTGG - Intronic
1136281201 16:29212422-29212444 CAGGCTATGAACGGGGCTGCAGG + Intergenic
1136775217 16:32868201-32868223 CAGGCCAGGCAAGCGGCTGCTGG - Intergenic
1136895400 16:33993311-33993333 CAGGCCAGGCAAGCGGCTGCTGG + Intergenic
1137405683 16:48187448-48187470 CAGACCATGAGAGAAGCTGCAGG + Intronic
1137818527 16:51422017-51422039 CAGCCCATGAAAGCAGCTGGGGG - Intergenic
1138436574 16:57003974-57003996 CAGGCACTGAGAGAAGCTGACGG + Intronic
1138748562 16:59391883-59391905 AAGGCAGTGAAAGAAGATGCTGG + Intergenic
1138868482 16:60851578-60851600 TAGGCAATGACAGCAGCGGCTGG - Intergenic
1139472893 16:67187645-67187667 CAGGCTGTGGAAGCAGCTGCAGG - Exonic
1140112704 16:72017399-72017421 CAGGCAATGAGGGCAGGAGCAGG + Intronic
1140141660 16:72264096-72264118 CAGGCAATGGAAGGAGCTGAAGG + Intergenic
1140856628 16:78983646-78983668 CAGCCAATGGAATCGGCTGCAGG + Intronic
1140894296 16:79311527-79311549 CCTGCAGTGAAAGCAGCTGAGGG - Intergenic
1141288084 16:82691329-82691351 CAGGCTATGCAAGCTGCTACTGG - Intronic
1141452680 16:84116508-84116530 CAGGCAACGGAACAAGCTGCCGG + Intronic
1141547734 16:84782763-84782785 CAAGCAATGAAAGCAGGGGCTGG - Intergenic
1141860386 16:86712344-86712366 CAGGTAATGCACCCAGCTGCGGG - Intergenic
1142004327 16:87682142-87682164 CAGGAAATGAAGCAAGCTGCTGG - Intronic
1142085565 16:88178345-88178367 CAGGCTATGAACGGGGCTGCAGG + Intergenic
1142439460 16:90086123-90086145 CAGCCCATGAGAGCAGCTGTGGG + Intronic
1203077634 16_KI270728v1_random:1130310-1130332 CAGGCCAGGCAAGCGGCTGCTGG - Intergenic
1142909851 17:3079715-3079737 CAGCCCATGAAAGAAGTTGCAGG - Intergenic
1142924651 17:3224094-3224116 CAGCCCATGAAAGAAGTTGCAGG + Intergenic
1143385660 17:6528868-6528890 CAGGCAAAGAGGGGAGCTGCAGG + Intronic
1143453215 17:7049169-7049191 CAGGCAAAGGAAGCAGCTTGTGG + Intergenic
1143636662 17:8167954-8167976 CAGGCAACATAAGCAGCTGCAGG + Intergenic
1143805094 17:9419603-9419625 CATGCAATGTAAGAAGCTGTTGG - Intronic
1143972241 17:10804034-10804056 CAGGCAGAGAAGGCAGCAGCAGG - Intergenic
1144351824 17:14403883-14403905 CAGTCAATGAAAGACACTGCAGG - Intergenic
1145022626 17:19443541-19443563 CAGCCCATGAAAGCAGCTGAGGG + Intergenic
1146391830 17:32429995-32430017 CAGCCCATGAAAGCACCTGCAGG + Intergenic
1147338131 17:39739111-39739133 CAGAGAATGAATGCATCTGCCGG + Intronic
1149692098 17:58586046-58586068 ATGGCAAAGAAAGCAGCTACTGG - Exonic
1149877400 17:60249632-60249654 GAGGAAATGAAAGCTGCTCCTGG + Intronic
1150358217 17:64506302-64506324 CAGACTATAAAAGCGGCTGCCGG - Exonic
1150610651 17:66730657-66730679 AAGGCAATGAAAGCAGTCTCAGG - Intronic
1150723477 17:67633153-67633175 CCTGCAATGACAGCAGATGCAGG + Intronic
1151726200 17:75886114-75886136 CAGGCAAGGAAAGCGTGTGCAGG - Intronic
1152670504 17:81601908-81601930 CAAACTCTGAAAGCAGCTGCAGG + Intronic
1152958111 18:57533-57555 CAGCCCATGAGAGCAGCTGTGGG - Intronic
1153987323 18:10364690-10364712 CAGGCAAGTAAAGCAGCTGGAGG - Intergenic
1154425975 18:14272353-14272375 CAGCCCATGAAAGCAGCTGCAGG - Intergenic
1154428718 18:14291946-14291968 CAGCCCGTGAGAGCAGCTGCAGG - Intergenic
1154430047 18:14301474-14301496 CAGCCCATGAGAGCAGCTACAGG - Intergenic
1154430992 18:14308291-14308313 CAGCCCATGAGAGCAGATGCAGG - Intergenic
1154432334 18:14317814-14317836 CAGCCCATGAGAGCAGCTACAGG - Intergenic
1154433665 18:14327593-14327615 CAGCCCATGAAAGCAGCTGCAGG - Intergenic
1155018925 18:21876733-21876755 CAGGCAATAAAAGATGCTGGTGG + Intergenic
1155707786 18:28837933-28837955 CAGCCCATGAAAGCAGCTGTGGG - Intergenic
1155798826 18:30074249-30074271 CAAGCCATGAGAGCAGCTGTAGG + Intergenic
1155846186 18:30709760-30709782 CATGTAATGAAAGCAGTTGCTGG - Intergenic
1156351224 18:36303002-36303024 GAGGCCATGACAGCACCTGCTGG - Intronic
1156355024 18:36333286-36333308 CAGGTAAAGACAGCTGCTGCTGG + Intronic
1156568355 18:38222093-38222115 CAGCCAATGGGAGCAGCCGCTGG + Intergenic
1156914329 18:42447665-42447687 CAGCCTTTTAAAGCAGCTGCAGG - Intergenic
1157914871 18:51655004-51655026 AAAACAATGAAAGCATCTGCAGG - Intergenic
1157941155 18:51930318-51930340 CAGCCTGTGAAAGCAGCTGGTGG + Intergenic
1158129780 18:54139867-54139889 CAGCCCATGAAAGCAGCCACAGG + Intergenic
1158908275 18:62035105-62035127 CAGGCAAAAAAAGCATGTGCAGG - Intergenic
1159265470 18:66073475-66073497 CAGCCCATGATAGCAGCTGGGGG - Intergenic
1159651774 18:70986581-70986603 CAGCCCATGAAAGCAGCTGTGGG + Intergenic
1159892268 18:73964101-73964123 CAGCCAGTGAAGGCAGCTGTGGG - Intergenic
1161166243 19:2789360-2789382 CTGGCAGCGAGAGCAGCTGCGGG - Intronic
1163998706 19:21077262-21077284 CAGCTTGTGAAAGCAGCTGCAGG + Intergenic
1164036571 19:21460917-21460939 CAGCTTGTGAAAGCAGCTGCAGG - Intronic
1164086078 19:21903832-21903854 CAGGCCATGAAAGCAGCCACGGG - Intergenic
1164301550 19:23966720-23966742 CAAGCAATGAGAGCAGCTTTAGG + Intergenic
1164449174 19:28345176-28345198 CAGGAAGTGGAAGGAGCTGCTGG + Intergenic
1164489388 19:28692731-28692753 CAGCCAGTGAGAGCAGCTGCAGG + Intergenic
1165301295 19:34971064-34971086 AAGGAATTGAAAGCAGCTTCAGG - Intergenic
1167569956 19:50280700-50280722 CAGGTAAAGAAAGAAGCTTCTGG - Intronic
1168156067 19:54473488-54473510 CAGACAGTGAAAGCAGCAGGAGG + Intergenic
1168559888 19:57373861-57373883 CAGCCCATGAAAGCAGCTGAGGG - Intronic
1202637983 1_KI270706v1_random:58460-58482 CAGCCCATGAGAGCAGCAGCAGG + Intergenic
925487280 2:4349336-4349358 CAGCCAATGAGAGAAGCTGCAGG - Intergenic
926467940 2:13214822-13214844 CAGCCTGTGAAAGCAGCTGGGGG - Intergenic
926526833 2:13991851-13991873 CAGCCTATGAAAGCAGCTGGGGG - Intergenic
926769058 2:16351794-16351816 CAGCCCATGAAAGCAGCTGCAGG + Intergenic
927302879 2:21536209-21536231 CAGCCCATGAAAGCAGCTGTGGG + Intergenic
928047464 2:27951031-27951053 CTGGCAAAGAAAACAGTTGCGGG - Intronic
928088942 2:28362339-28362361 CAGGGAATAAAAGCAGCTGGTGG - Intergenic
928130860 2:28649136-28649158 AAGCCAATGAAAGCACCTGATGG + Intergenic
928254468 2:29710134-29710156 CAGGCAAAGAGAGCATGTGCAGG - Intronic
929081655 2:38127913-38127935 CAGTCCATGAAAGCAGCCACAGG + Intergenic
929611915 2:43277059-43277081 CAGGCAGGGAAATCAGCTGGGGG - Intronic
932766644 2:74474747-74474769 CAGGCTATTGAGGCAGCTGCTGG + Exonic
932923349 2:75942250-75942272 CAGCCCATGAAAGCAGCTGTGGG + Intergenic
933584954 2:84169835-84169857 CAGGCAAAGAAAGCTTGTGCAGG - Intergenic
933625046 2:84588559-84588581 TAGGAAATGAAAGCAGATGAGGG + Intronic
933985862 2:87591709-87591731 CAGTCCATGAGAGCAGCTGTGGG + Intergenic
934493628 2:94779393-94779415 CAGCCCATGAGGGCAGCTGCGGG - Intergenic
934558664 2:95300903-95300925 CAGCCAGGAAAAGCAGCTGCTGG + Intronic
935064130 2:99633465-99633487 CAGGAAAGGAAAACAGCTCCAGG + Intronic
935351152 2:102152665-102152687 CCAGATATGAAAGCAGCTGCTGG - Intronic
935798777 2:106671509-106671531 CAGCCCTTGAGAGCAGCTGCAGG + Intergenic
936014466 2:108947288-108947310 CAGCCCATGAAAGCAGTTACAGG - Intronic
936161845 2:110089344-110089366 CAGTTTGTGAAAGCAGCTGCAGG + Intronic
936182818 2:110282010-110282032 CAGTTTGTGAAAGCAGCTGCAGG - Intergenic
936307977 2:111359095-111359117 CAGTCCATGAGAGCAGCTGTGGG - Intergenic
936661992 2:114553043-114553065 CATGCAATGAAAGCTGCATCTGG - Intronic
936788737 2:116125296-116125318 CAGCCAGGGAAAGCAGCTGTGGG - Intergenic
937380796 2:121374572-121374594 CAGTCCATGAAAGCAGCTGTAGG + Intronic
938092158 2:128441066-128441088 AAGGCAAAGGAAGCAGGTGCCGG - Intergenic
940338899 2:152558630-152558652 CAGGCAATGAAAGTTTCTGGTGG + Intronic
940402839 2:153267214-153267236 CAGCCTGTGAAAGCAGCTTCAGG - Intergenic
940426866 2:153540593-153540615 CAGCCAATGAAAGCAGCCCCCGG + Intergenic
940903386 2:159147135-159147157 GAGGCAGAGAGAGCAGCTGCAGG - Intronic
941261853 2:163307256-163307278 CAGCCCATGAGAGCAGCTCCAGG + Intergenic
941332398 2:164194785-164194807 CAGGCAAAGAGAGCATGTGCAGG - Intergenic
941454461 2:165698490-165698512 CAGACAATTAAAGCAGCAGCAGG + Intergenic
941708748 2:168688858-168688880 CATGCAATGAAAGCAGATCTAGG + Intronic
941765545 2:169292569-169292591 CAGGAAATGAACTCAGGTGCCGG + Intronic
943248396 2:185485116-185485138 CAGCCCATGAAAGCAGCTGTTGG + Intergenic
943530519 2:189074506-189074528 CAGGCAATAAATACAGCTGTGGG - Intronic
943832374 2:192478872-192478894 CGGCCCATGAAGGCAGCTGCAGG + Intergenic
943880005 2:193131317-193131339 CAGCCTGTGAAAGCAGCTGCAGG - Intergenic
944307412 2:198194146-198194168 CAGTCCATGAAAGAAGCTGTGGG - Intronic
945062937 2:205924571-205924593 GAGGCAAGGAAAGCAGGTGGGGG + Intergenic
946112417 2:217431622-217431644 CAGGCATTGAAAGCTGCTGTGGG + Intronic
946141758 2:217697209-217697231 CAGGAAATGAAAGTAGGGGCAGG + Intronic
946143492 2:217711581-217711603 CAGGAACTCAAAGCACCTGCAGG + Intronic
946317094 2:218923575-218923597 CAGCCCATGAAAGCAGCTATGGG - Intergenic
946441444 2:219700394-219700416 CAGGGAGTGAAAGGAGCTGAAGG - Intergenic
946968682 2:225067813-225067835 CAGCCCATGAAAGCAGCTGAAGG + Intergenic
947256686 2:228173596-228173618 CAAGCAATGTAAGCAGCCTCCGG + Intronic
947488137 2:230571205-230571227 CAGCCTATGAAAGCAGCTGAGGG - Intergenic
947712525 2:232324181-232324203 GAGGCCATGAAGGCAGCTGCTGG - Intronic
947719919 2:232363996-232364018 GAGGCCATGAAGGCAGCTGCTGG - Intergenic
947731490 2:232433861-232433883 GAGGCCATGAAGGCAGCTGCTGG - Intergenic
948292371 2:236835319-236835341 CAGCCCATGAAAGCAGCTGCAGG - Intergenic
1169147702 20:3264271-3264293 CTGGCAAGGCCAGCAGCTGCCGG + Intronic
1169372829 20:5041768-5041790 CAGGCACTGTCAGCATCTGCAGG - Intergenic
1169785370 20:9354126-9354148 AAAGCAATGCAGGCAGCTGCAGG - Intronic
1170096529 20:12651338-12651360 CAGATAATAATAGCAGCTGCAGG - Intergenic
1170152130 20:13236896-13236918 CAGCCCCTGAAAGCAGCTGGAGG - Intronic
1170413022 20:16110831-16110853 CAGGCAATGAAAACCACTGTGGG + Intergenic
1170589032 20:17757216-17757238 AAGCCAATGACAGCGGCTGCTGG - Intergenic
1170852376 20:20017105-20017127 CTGGGAAGGAAAGAAGCTGCTGG - Exonic
1171001835 20:21423035-21423057 CAGCCTGTGAAAGCAGCTGTGGG - Intergenic
1171085229 20:22232575-22232597 CAGGCAATGAGTGCAGCTGCTGG + Intergenic
1171422322 20:25025438-25025460 CAGAAAATGAACGCAGATGCTGG - Intronic
1171818677 20:29812525-29812547 CAGCCCATGAGAGCAGCTGTGGG - Intergenic
1171884553 20:30642535-30642557 CAGCCCATGAGTGCAGCTGCAGG + Intergenic
1171884777 20:30644009-30644031 CAGCCCATGAGGGCAGCTGCGGG - Intergenic
1171899124 20:30840500-30840522 CAGCCCATGAGAGCAGCTGTGGG + Intergenic
1172380108 20:34482637-34482659 CAGCCCATGAAAGCAGCCGGTGG - Intronic
1172957901 20:38774644-38774666 CAGACAATGAAAGCAAAAGCAGG - Intergenic
1175053684 20:56178422-56178444 CAGGGAGTGAAGGAAGCTGCAGG + Intergenic
1175261844 20:57679664-57679686 CAGGATGTGAAAGCAACTGCTGG + Intronic
1176262564 20:64190108-64190130 GAGGCAAGGCCAGCAGCTGCAGG + Exonic
1176843367 21:13858151-13858173 CAGCCCATGAAAGCATCTGCAGG + Intergenic
1176844701 21:13867937-13867959 CAGCCCATGAGAGCAGCTACAGG + Intergenic
1176847444 21:13887501-13887523 CAGCCCATGAGAGCAGCTACAGG + Intergenic
1177169532 21:17640271-17640293 TAGCCCATGAAAGCAGCTGCAGG - Intergenic
1177306010 21:19317077-19317099 CAGCCCAGGAAAGCAGCTGCAGG - Intergenic
1177367165 21:20153345-20153367 CAGGCTATGAAAGCAGCTGCAGG - Intergenic
1177402397 21:20623153-20623175 CAGCCTATGAAAGCAGCTGCAGG - Intergenic
1177504254 21:22000465-22000487 CAGCCCATGAAAGCAGCCGGGGG - Intergenic
1177765205 21:25449937-25449959 CAGCCCGTGAAAGCAGCTGTGGG - Intergenic
1177803282 21:25848981-25849003 CAGCCTGTGAAAGCAGCTGTGGG + Intergenic
1178112836 21:29386230-29386252 CATGTAATGAAAGCCGCTGAAGG - Intronic
1178154167 21:29832210-29832232 CAGTCCAGGAAAGCAGCTGAGGG - Intronic
1178945065 21:36940163-36940185 CAGCTAATAAAAGCAGCTGTCGG - Intronic
1179380858 21:40897756-40897778 CAGCCTATGAGAGCAGCTGTGGG + Intergenic
1179600899 21:42476634-42476656 CTGGCACTGACAGCAGCTGAGGG - Intronic
1180195144 21:46189636-46189658 CAGGCAATGACAGGATCTGAGGG + Exonic
1180322122 22:11331899-11331921 CAGCCCATGAGAGCAGCTGTGGG - Intergenic
1180332791 22:11547803-11547825 CAGCCCATGAGAGCAGCTGTGGG + Intergenic
1181636915 22:24178776-24178798 CAGGCAACCAAAGCAGCGGCTGG + Intergenic
1181876195 22:25942829-25942851 CAGTCAATGGAGACAGCTGCTGG - Intronic
1182815225 22:33156301-33156323 CAGCCCATGAAAGCAGCTGGTGG + Intergenic
1182866810 22:33611282-33611304 CAACCCATGAGAGCAGCTGCAGG + Intronic
1183063452 22:35348951-35348973 GGGGCAAGGAAAGCAGCTGGGGG + Intergenic
1183717287 22:39540799-39540821 CAGGGAAGGAAACCAGCTGGGGG + Intergenic
1184030872 22:41893762-41893784 CAGGCATTGGAAGGAGGTGCTGG + Intronic
1184499815 22:44864863-44864885 CAGTCACTGAAAGCAACTGCTGG + Intergenic
1184789863 22:46693469-46693491 CAGGCAAAGCAAGCAGCAGCTGG - Exonic
949568735 3:5270755-5270777 CAGGAAATGAGGGCAGCCGCTGG - Intergenic
949584428 3:5424027-5424049 CCAGCAGTGAAAGCAGGTGCTGG - Intergenic
949692333 3:6654659-6654681 CAGCTTATGAAAGCAGCTGCAGG - Intergenic
951113277 3:18831213-18831235 CAGGCAAAGAGAGCCTCTGCAGG - Intergenic
951596351 3:24322533-24322555 CAGGCAAAGAAAGGAGTTTCAGG - Intronic
952827914 3:37539342-37539364 CAGGAAAGGAAGGCAGTTGCAGG + Intronic
953245326 3:41185689-41185711 CAGGTAATGCAAGCAGAGGCTGG + Intergenic
953898444 3:46823031-46823053 CAGCCCATGAAAGCAGCTGCGGG - Intergenic
954253730 3:49389043-49389065 CAGAGACAGAAAGCAGCTGCTGG + Intronic
955395461 3:58554092-58554114 CAGCCCATGAAAGCACCCGCAGG - Intergenic
956489241 3:69753563-69753585 CAGCCCTTGAGAGCAGCTGCAGG + Intronic
956572494 3:70712425-70712447 CAGCCCATGAAAGCAGCTGTGGG - Intergenic
956937072 3:74115157-74115179 CTAGCAATAAAAGCAGGTGCTGG - Intergenic
957087820 3:75698923-75698945 CAGCCCATGAGAGCAGCTGTGGG + Intergenic
957412850 3:79862722-79862744 CAGCCCATGAAAGCAGCTGCAGG + Intergenic
957524173 3:81358471-81358493 CAGCCCATGAAAGCAGCCACAGG + Intergenic
957783413 3:84849021-84849043 CAGCCCATGAAAACAGCTGTGGG - Intergenic
958583958 3:96061864-96061886 CAGCCCATGAAAGCAGCTGCAGG + Intergenic
958836908 3:99156914-99156936 CAGCCCAAGAAAGCAGCTTCAGG + Intergenic
959149499 3:102591550-102591572 CAGCCAGTGAAAGCAGCTGAGGG + Intergenic
959171317 3:102847747-102847769 CAGCCAGTGAAAGCAGCTGCAGG - Intergenic
959183136 3:103007666-103007688 CAGCCTGTGAAAGCAGCTGTGGG - Intergenic
959337004 3:105079418-105079440 CAGCCTGTGAAAGCAGCTGCAGG - Intergenic
959507445 3:107171630-107171652 CAGGCTGTGAAAGCAGCCACAGG + Intergenic
960256470 3:115516370-115516392 CAGCCCATGAGAGCAACTGCAGG - Intergenic
960724687 3:120658505-120658527 CAGCCCATGAGAGCAGCCGCAGG - Intronic
962231407 3:133668706-133668728 CATGCAATGAACACAGATGCTGG - Intergenic
963059413 3:141212752-141212774 CAGACAGTGAAGGCAGGTGCTGG + Intergenic
963471561 3:145748147-145748169 CAGCCTATGAAAGCAGCCACAGG - Intergenic
964056980 3:152472878-152472900 CACGCAAGGAAACCAGCTGTTGG + Intergenic
964310537 3:155387002-155387024 CAAGCAATGACATCTGCTGCTGG + Intronic
964853420 3:161119360-161119382 CAGCCCATGAAAGCAGCTGGAGG + Intronic
964933969 3:162059315-162059337 CAGTCTGTGAAAGCAGCTTCAGG - Intergenic
965046465 3:163584610-163584632 CAGCCTGTGAAGGCAGCTGCAGG - Intergenic
965198573 3:165629057-165629079 CAGCCCATGAAGGCAGCTGGAGG - Intergenic
965404817 3:168255628-168255650 CAGCCCATGAAAGCAGCCACAGG - Intergenic
965869885 3:173252793-173252815 CAGTTCATGAGAGCAGCTGCAGG - Intergenic
966346857 3:178990009-178990031 CAGTCCATGAGAGCAGCTGCAGG - Intergenic
967078427 3:186026215-186026237 CAGGCAAAGAGAGCATGTGCAGG - Intergenic
967513616 3:190341051-190341073 CAGCCCATGAAAGCAGCTGGAGG - Intronic
967539468 3:190648600-190648622 CAGGTTCTGGAAGCAGCTGCAGG + Intronic
968466154 4:752492-752514 CAGGCTCTGGAAGCAGCAGCTGG - Intronic
968695802 4:2025791-2025813 CAGCCTGTGAAAGCAGCTGTGGG - Intronic
969182202 4:5450870-5450892 CAGGCACTGAGAGCAGAGGCTGG + Intronic
970036225 4:11738634-11738656 CAGACCATGAAGGCAGCTGCAGG + Intergenic
970100415 4:12515045-12515067 TAGCCTATGAAAGCAGCTGCAGG + Intergenic
970744756 4:19281428-19281450 CAGACTGTGAAAGCAGCTGTGGG - Intergenic
971545421 4:27879762-27879784 CAGCCCATGAGAGCAGCTGTGGG - Intergenic
971675897 4:29629054-29629076 CAGGCAATGAAAACAGCATTTGG + Intergenic
971856698 4:32053695-32053717 CAGCCAATGAAAGCAGCTGCAGG - Intergenic
972844365 4:42970181-42970203 CAGCCCATGAAAGCAGCTTCTGG - Intronic
973001844 4:44961487-44961509 CAGGCATTCAAAGCATCTGCTGG - Intergenic
973032562 4:45361999-45362021 CAGCCTATGAAAGCAGCTGTGGG + Intergenic
973123049 4:46546557-46546579 CAGGGAATGAATGGAGCTGGAGG - Intergenic
973368205 4:49224821-49224843 CAGCCCATGAGAGCAGCTGCAGG + Intergenic
973392842 4:49570604-49570626 CAGCCCATGAGAGCAGCTGCAGG - Intergenic
973780350 4:54283033-54283055 CAGCCCCTGAGAGCAGCTGCAGG - Intronic
974259238 4:59503551-59503573 CAGGCACTGAACCCAGCTGAGGG + Intergenic
974713403 4:65633338-65633360 CAGGAATTGAAAACAGCTGAAGG + Intronic
974867406 4:67597565-67597587 CAGCCCATGAAAGCAGCCGCAGG + Intronic
975301661 4:72797673-72797695 CAGCCCATGAAAGCAGCTAAGGG - Intergenic
975637424 4:76464132-76464154 CAGCCTGTGAAAGCAGCTGTGGG + Intronic
976706756 4:88027216-88027238 CAGCCTGTGAAAGCAGCTGCAGG + Intronic
976842246 4:89445294-89445316 CAGCCTATGAAAGCAGCCACAGG - Intergenic
976853466 4:89576113-89576135 CAGCCCATGAAAGCAGCTGCTGG + Intergenic
976949686 4:90813410-90813432 CAGGCTGTGAAAGGAGCCGCAGG - Intronic
977050173 4:92119585-92119607 CAGCCTGTGAAAGCAGCTGAGGG + Intergenic
977309776 4:95371520-95371542 CAGGCAATGTATGTAGATGCAGG - Intronic
977396608 4:96479000-96479022 CAGCCCCTGAAAGCAGCTGCAGG + Intergenic
978591629 4:110330171-110330193 TAGCCCATGAAAGCAGCTGTAGG + Intergenic
978809794 4:112837575-112837597 CAGCCCATGAAAGCAGCCTCAGG + Intronic
979060847 4:116058942-116058964 CAGCCTGTGAAAGCAGCTGCAGG - Intergenic
979087250 4:116428620-116428642 CAGTCTGTGAAAGCAGCTGTGGG + Intergenic
979122491 4:116920895-116920917 CAGCCCATGAAAGAAGCTGTGGG + Intergenic
979805088 4:124961095-124961117 CAGCCCATGAAAGCAGCCACAGG - Intergenic
979881892 4:125970552-125970574 CAGACCATGAAAGCAGCCACTGG - Intergenic
980090760 4:128440893-128440915 CAGCCCATGAAAACAGCTGTGGG - Intergenic
980153660 4:129079595-129079617 CAGACTGTGAAAGCAGCTGCAGG - Intronic
980383585 4:132058569-132058591 CAACCCATGAAAGCAGCTGCAGG + Intergenic
981121126 4:141052032-141052054 CAGGCAAAGAGAGCTTCTGCAGG + Intronic
981176817 4:141691763-141691785 CAGCCCATGAAAGCAGCTAAAGG - Intronic
981411942 4:144442404-144442426 CAGCCTGTGAAAGCAGCTTCAGG - Intergenic
982432465 4:155338384-155338406 CAGCTCATGGAAGCAGCTGCAGG + Intergenic
982584872 4:157222927-157222949 CAGGAAATGATGGCAGCTGCTGG - Intronic
982627504 4:157786002-157786024 CAACCTGTGAAAGCAGCTGCAGG - Intergenic
982635001 4:157884440-157884462 TGGGGAATGAAAGCAGGTGCTGG - Intergenic
982797476 4:159663519-159663541 CAGTCCACGAAAGCAGCTACAGG - Intergenic
983132802 4:164043031-164043053 CAGCCCATGAAAGCAGCCACAGG - Intronic
983475126 4:168203881-168203903 CAGGCTGTAAAAGCAGCTGTGGG + Intergenic
983665531 4:170177345-170177367 CAGCCTGTTAAAGCAGCTGCAGG + Intergenic
984026373 4:174547893-174547915 CAGCTCATGAAAGCAGCTGGGGG + Intergenic
984372216 4:178882637-178882659 CAGCCCATGAAAGCAGATGACGG + Intergenic
984396016 4:179200901-179200923 CCTGCAATGAAAAGAGCTGCAGG - Intergenic
984477265 4:180252275-180252297 CAGTTAGTGAAAGCAGCTGAGGG - Intergenic
984516957 4:180752833-180752855 CAGCCCATGAAAGCAGCTGGAGG - Intergenic
985368381 4:189258801-189258823 CAGCCTGTGAAAACAGCTGCAGG + Intergenic
985368551 4:189260506-189260528 CAGCCTGTGAAAGCAGCTGCAGG - Intergenic
1202765306 4_GL000008v2_random:144317-144339 CAGCCCATGAGAGCAGCAGCAGG + Intergenic
986557715 5:9027742-9027764 CAGCCAGTGAAAGCAGCTGCAGG + Intergenic
986805945 5:11309276-11309298 CAGCCCATGAAAGCAGCTGAGGG + Intronic
987512405 5:18856761-18856783 CAACCCATGAAAGCAGCTGGGGG + Intergenic
987816612 5:22909499-22909521 CAGGTACTGAAAATAGCTGCAGG + Intergenic
987967304 5:24893250-24893272 CATCCCATGAAAGCAGCTGTAGG - Intergenic
988016176 5:25563126-25563148 CAGCCCATGAAAGCAGTGGCAGG - Intergenic
988142678 5:27263943-27263965 CAACCTGTGAAAGCAGCTGCAGG + Intergenic
988159614 5:27502755-27502777 CAGCCCATGAAGGCAGCTGTGGG - Intergenic
988272294 5:29032619-29032641 CAGCCCATGAATGCAGCTGCAGG - Intergenic
988386631 5:30574054-30574076 CAGCCCATGAAAGCAGCTGCAGG + Intergenic
988448042 5:31310387-31310409 CAGCCCATGAAAGCAGCCTCGGG - Intronic
988579750 5:32458634-32458656 CAGCCCATGAAAGCAGCCACAGG - Intergenic
988671350 5:33385282-33385304 CAGCCCATGAGAGCAGCTGCAGG - Intergenic
988822299 5:34899289-34899311 AAGGCAATGAGATCTGCTGCTGG + Intronic
989254368 5:39350758-39350780 CAGCCCATGAAAGCAGCTGCAGG - Intronic
989746881 5:44839682-44839704 CAGCCCATGAAAGCAGCTGCAGG + Intergenic
991122584 5:63032989-63033011 CAGCCCATGAAAGCAGCCACAGG + Intergenic
991136301 5:63186042-63186064 CAGCCTGTGAAAGCAGCTGTGGG + Intergenic
991186612 5:63815839-63815861 CAGTCCATGAAAGCAGCTGAGGG + Intergenic
991355703 5:65767006-65767028 CAGCCTGTGAAAGCAGCTACAGG - Intronic
993253095 5:85553422-85553444 CAGCCCATGAAAGCAGCCACAGG - Intergenic
993275323 5:85850045-85850067 CAGCCCATGAAAGCAGCTGAGGG - Intergenic
993390931 5:87319163-87319185 CAGCCCATTAAAGCAGCTGTGGG - Intronic
994137182 5:96301799-96301821 CAGTCCATGAAAGCAGCTACAGG - Intergenic
994464659 5:100111592-100111614 CAGGCAAGGAAAGCATGTGCAGG + Intergenic
994464765 5:100112297-100112319 CAGGCAAGGAGAGCATGTGCAGG + Intergenic
995536596 5:113142830-113142852 CAGTGAATCAAAGCAGCAGCAGG + Intronic
995683496 5:114745874-114745896 CAGCCTGTGAGAGCAGCTGCAGG + Intergenic
995779754 5:115762656-115762678 CAGCCAGTGAAAGCAGCTGTGGG - Intergenic
995915641 5:117241895-117241917 CAGCCGGTGAGAGCAGCTGCAGG + Intergenic
996046709 5:118882333-118882355 CAGCCCATGAAAGCAGCCGTAGG - Intronic
996232855 5:121087746-121087768 CAGCCCATGAAAGCAGCTGTGGG - Intergenic
996755429 5:126930234-126930256 CAGGCAAGGAAAACAGCATCTGG - Intronic
997091522 5:130864294-130864316 CAGCTCATGAAAGCAGCTGCAGG - Intergenic
997100052 5:130958653-130958675 CAGCCCATGAAAGCAGCCACAGG + Intergenic
998294293 5:140952169-140952191 CAACCCATGAGAGCAGCTGCAGG - Intronic
998487745 5:142517660-142517682 CAGCCTATGAAAGCAGCTTGAGG + Intergenic
998581812 5:143384738-143384760 TAGCCTGTGAAAGCAGCTGCAGG - Intronic
998975110 5:147636649-147636671 GAGGCAAAGAACGCAGCTGGAGG + Intronic
999906198 5:156143523-156143545 CAGTCCATGAGAGCAGCTGCAGG + Intronic
1000548808 5:162633888-162633910 AAGCCCATGAAAGCAGCTGCAGG - Intergenic
1000575023 5:162966478-162966500 CAGCCAATGAAAGCAGCCCTGGG - Intergenic
1000768287 5:165318874-165318896 CAGCCCATGAAAGCAGCTGGGGG - Intergenic
1001137478 5:169114682-169114704 GTGGCCAAGAAAGCAGCTGCAGG - Intronic
1002300204 5:178253413-178253435 CAGTGAATGAAAGCAGGTGTTGG - Intronic
1002892978 6:1352809-1352831 CAGCCCATGAAAGCAGCTGGAGG - Intergenic
1002904148 6:1435328-1435350 CAGGAACTGTAAGAAGCTGCTGG + Intergenic
1003415791 6:5906622-5906644 CAGGCAATGAAAACTACAGCTGG + Intergenic
1003817907 6:9862578-9862600 CAGGCCATGAAAGCAGCTGTGGG - Intronic
1004097703 6:12575061-12575083 AAGGCAATGAAGGTAGTTGCGGG - Intergenic
1004738114 6:18428704-18428726 CTGGCAATGAAAACAACTGGGGG - Intronic
1006476806 6:34260852-34260874 CAGCCTGTGAAAGCAGCAGCAGG - Intergenic
1006741745 6:36313654-36313676 CAGTCAAAGGAAGCAGCTGGAGG + Intergenic
1007385937 6:41520151-41520173 CAGGGGCTGAAAGGAGCTGCAGG + Intergenic
1007685925 6:43667445-43667467 CAGCCTTTGAAAGCTGCTGCTGG + Intronic
1007839374 6:44703083-44703105 CAGGCAATGGAGCCAGCTGCTGG + Intergenic
1008525560 6:52403754-52403776 CAGCCACAGAAGGCAGCTGCTGG - Exonic
1008753892 6:54770526-54770548 CAGGCACTGAAGGCGGCGGCAGG + Intergenic
1008831876 6:55774463-55774485 CAGTGAGTGAAAGCAGCTGGAGG - Intronic
1010360517 6:74987607-74987629 CAGCCCATGAAAGCAGCCACTGG + Intergenic
1010821749 6:80422555-80422577 CAGCCCATGAAAGCATCTGTGGG + Intergenic
1010860130 6:80900074-80900096 CAGCTCATGAAAGCAGCTGCAGG - Intergenic
1012125237 6:95420478-95420500 CAGCCCATAAAAGCAGCTGTGGG - Intergenic
1013716358 6:112967682-112967704 CAGCCCATGAAAGCAGCTGCAGG - Intergenic
1014354618 6:120390380-120390402 CAGGCATTGAAAAGATCTGCTGG - Intergenic
1015343637 6:132130696-132130718 CAGGAAAAGAAGGCAGATGCTGG - Intergenic
1015462646 6:133510545-133510567 CAAGCAATGATAGTAACTGCTGG - Intronic
1015652552 6:135479307-135479329 CAGCCAGTGAAAGCAGCTGCAGG + Intronic
1016094299 6:140017095-140017117 TAGGCGAAGAAAGCAGGTGCTGG + Intergenic
1016094594 6:140020198-140020220 CAGCCTATGAAAGCAGCCCCGGG - Intergenic
1016128375 6:140434390-140434412 CAGCCAATGAAAGCAGCCGCAGG + Intergenic
1016438144 6:144058855-144058877 CAGCCTGTGAGAGCAGCTGCAGG - Intronic
1016513002 6:144864279-144864301 CAGCCCATGAAGGCAGCTGTAGG + Intergenic
1017430894 6:154369765-154369787 CAGGCAATGGAAGCAGAGACCGG - Intronic
1017654389 6:156613712-156613734 CAGCCCCTGAAAGCAGCTGCAGG - Intergenic
1018358299 6:163040540-163040562 CAGCCCGTGAAAGCAGATGCAGG + Intronic
1018407739 6:163505420-163505442 CAGCCCATGAAAGCAGCCGAGGG + Intronic
1018502175 6:164422823-164422845 CAGCCTGTGAAAGTAGCTGCCGG + Intergenic
1018592612 6:165443454-165443476 CAGCCCATGAAAGCAGCCACAGG - Intronic
1019296159 7:276491-276513 CAGGCAGTGGAAGCAGATACCGG + Intergenic
1019595321 7:1855720-1855742 CAGGCCATGAAAGGTGATGCTGG - Intronic
1019649031 7:2146582-2146604 CGGGTCATGAGAGCAGCTGCTGG - Intronic
1020257987 7:6512951-6512973 CCTGCTATGAAAGCCGCTGCAGG - Intronic
1020450452 7:8315580-8315602 CAGCCCATGACAGCAGCTACAGG - Intergenic
1020546654 7:9541265-9541287 CAGCCTGTGAAAGCAGCTGTGGG + Intergenic
1021525161 7:21578469-21578491 CAGCCAGTGAAAGCAGTTGTGGG - Intronic
1021617744 7:22520240-22520262 CATCCCATGAAAGCAGCTGGAGG + Intronic
1021787204 7:24164126-24164148 CAGCCTGTGAAAGCAGCTGCAGG + Intergenic
1022507685 7:30916701-30916723 CAGGCACTGAAAGGAGCTGCTGG - Intronic
1022705954 7:32802230-32802252 CAGCCCATGAGAACAGCTGCAGG - Intergenic
1022909105 7:34882919-34882941 CAGCCTATGAAAGCAGCGGGAGG - Intergenic
1022927333 7:35069716-35069738 CATCCCATGAAAGCAGCTGGAGG + Intergenic
1023153969 7:37229142-37229164 CAGGCACTGAAAACATTTGCGGG + Intronic
1023690341 7:42779591-42779613 CAGCCCATGAAAGTAGCTACAGG + Intergenic
1024614225 7:51095200-51095222 CAGGCAAAGACAGCATGTGCAGG + Intronic
1027341095 7:77209451-77209473 CAGCCCATGAAAGCAGGTGCAGG - Intronic
1027666527 7:81047519-81047541 TAGCCTGTGAAAGCAGCTGCAGG + Intergenic
1027789095 7:82616276-82616298 CAGCCATTGAAAACAGCTGTGGG - Intergenic
1027919184 7:84370179-84370201 CAGGCAAAGGAAGCAATTGCTGG + Intronic
1028134407 7:87210728-87210750 CAGCCTGTGAAAGCAGCTGTGGG - Intronic
1028374935 7:90135868-90135890 CATCCCATGAAAGCAGCTGGAGG - Intergenic
1028771232 7:94624222-94624244 CTGGCAATGATTGCAGCTGGAGG + Intronic
1030357271 7:108556660-108556682 CAGCCCATGAAAGCAGCTGTGGG - Intronic
1030673487 7:112362455-112362477 CAGGGAATGAAAGCTGATGAAGG - Intergenic
1030752225 7:113242053-113242075 CAGCTCATGAAAGCAGCCGCAGG + Intergenic
1030754223 7:113268847-113268869 CAGGCAATCAAAATACCTGCTGG + Intergenic
1031242620 7:119266070-119266092 CAGCCTGTGAAAGCAGCTGTGGG - Intergenic
1031435569 7:121728385-121728407 CAGCCCATAAAAGCAGCTGTGGG - Intergenic
1031668956 7:124519308-124519330 CAGCTCGTGAAAGCAGCTGCAGG + Intergenic
1031806774 7:126316796-126316818 CAGCCCATGAAAGCAGCTGTAGG - Intergenic
1032059774 7:128714942-128714964 CAGGTTATGGAAGCAGTTGCAGG - Intronic
1032346249 7:131119371-131119393 CAGCCCATGAAAGCAGCTGCAGG - Intronic
1032366817 7:131307479-131307501 CAGCCCATGAAAGCAGCTGCAGG + Intronic
1032546741 7:132750277-132750299 CTGTCAATGCAAGCAGCTGTTGG - Intergenic
1032572941 7:133020648-133020670 CAAGCAATGACAACAGCAGCAGG - Intronic
1032708150 7:134440075-134440097 AAGGCAGTGGAAGCAGCTGATGG - Intergenic
1032892033 7:136207313-136207335 CAGGCAAAGAAGGCATGTGCAGG - Intergenic
1032897574 7:136268479-136268501 CAGGCAAAGAGAGCATGTGCAGG + Intergenic
1034227816 7:149497173-149497195 CAGGCAGAGAAAGGAGCCGCGGG + Intronic
1034573099 7:151973025-151973047 CAGCCCTTGAAAGCAGCTGCGGG + Intronic
1035128654 7:156630279-156630301 CAGCCTGTGAGAGCAGCTGCAGG + Intergenic
1036914643 8:12793411-12793433 CAGTCTGTGAGAGCAGCTGCTGG - Intergenic
1037003310 8:13747407-13747429 CAGCCTGTGAAAGCAGCTGGAGG - Intergenic
1037277775 8:17200096-17200118 GGGGCACTGACAGCAGCTGCAGG - Intronic
1037810214 8:22082314-22082336 CAGGTGAGGAAAGCAGCTGGGGG - Exonic
1038099010 8:24351055-24351077 AAGGCAATGAAAGAGGCTGACGG + Intronic
1040005978 8:42621295-42621317 CAGGCAGTGTGAGAAGCTGCAGG + Intergenic
1041884691 8:62794873-62794895 AAGGCAATAAAAGAAGCAGCAGG - Intronic
1041927605 8:63252515-63252537 CAGCCTGTGAAAGCAGCTGTGGG + Intergenic
1043204990 8:77426613-77426635 CAGCCCATGAAAGCAGCTGTGGG + Intergenic
1043754402 8:83985057-83985079 CAGCCAGTGAAAGTAACTGCAGG + Intergenic
1043970896 8:86527320-86527342 CAGGGAATGAAAGGGGCTGCAGG - Intronic
1044326950 8:90869429-90869451 CAGCCCATGAAAGCAGCTACAGG + Intronic
1044356193 8:91225176-91225198 CAGGCAGTGGCAGCAGGTGCTGG + Intronic
1044414153 8:91917406-91917428 CTGACACAGAAAGCAGCTGCAGG - Intergenic
1044435512 8:92157919-92157941 CAGACAATTAAAGCTGCTGAGGG - Intergenic
1044494720 8:92863078-92863100 CAGGCAATGAAACCCACTCCTGG + Intergenic
1044806514 8:96013720-96013742 CAGGCAATGAAAATTGATGCTGG + Intergenic
1044893234 8:96859755-96859777 CATGCAATGAAAGAATCTGAAGG - Intronic
1045258111 8:100546758-100546780 CAGCCCATGAAAGCAGCCACAGG + Intronic
1045919451 8:107512076-107512098 CAGGCAAAGAGAGCATGTGCAGG - Intergenic
1046056207 8:109082089-109082111 CAGTCCATGAAGGCAGCTGCGGG - Intergenic
1046138044 8:110056516-110056538 CAGTCAGTGAAAGTAACTGCAGG + Intergenic
1046207071 8:111014903-111014925 CAGGCAAAGAAAGCTTATGCAGG - Intergenic
1046330152 8:112703277-112703299 CAGGCAAAGAAATCAGAAGCAGG + Intronic
1046352477 8:113033286-113033308 CCAGCCATGAAAGCAGCCGCAGG + Intronic
1046689540 8:117267414-117267436 CAGCCCATGAAAGCAGCTGCTGG - Intergenic
1047923338 8:129657491-129657513 CATCCTATGAAAGCAGCTGCAGG - Intergenic
1048190242 8:132281791-132281813 TAGGCAGTGAAAGCCACTGCAGG - Intronic
1048418603 8:134254005-134254027 CAAGTCATGAAAGCAGCTGCTGG - Intergenic
1048789972 8:138093052-138093074 CCAGCCGTGAAAGCAGCTGCAGG - Intergenic
1049159500 8:141088342-141088364 CAGACAAGGAAAGCAGTAGCAGG - Intergenic
1050402505 9:5271113-5271135 CAGCCCATGAAAGCAGCCTCAGG + Intergenic
1050643441 9:7693387-7693409 CAGCTTGTGAAAGCAGCTGCAGG + Intergenic
1050987484 9:12101843-12101865 CAGCCTGAGAAAGCAGCTGCAGG - Intergenic
1051194330 9:14546909-14546931 CAACCAATGAAAGCAGCCGTGGG - Intergenic
1051578138 9:18640871-18640893 TAGGCAATGAAATCAGAGGCTGG - Intronic
1052173784 9:25432553-25432575 CAGACCATGAAAGTAGCTGCAGG - Intergenic
1052628253 9:31004635-31004657 CAGGAAATGCAAGGAGCTGGAGG + Intergenic
1053663456 9:40300638-40300660 CAGCCCATGAGGGCAGCTGCGGG + Intronic
1053663959 9:40304535-40304557 CAGCCCATGAGGGCAGCTGCGGG + Intronic
1053664926 9:40310741-40310763 CAGCCCATGAGGGCAGCTGCGGG + Intronic
1053914501 9:42935791-42935813 CAGCCCATGAGGGCAGCTGCGGG + Intergenic
1054376085 9:64450769-64450791 CAGCCCATGAGGGCAGCTGCGGG + Intergenic
1054519688 9:66065543-66065565 CAGCCCATGAGGGCAGCTGCGGG - Intergenic
1054520655 9:66071750-66071772 CAGCCCATGAGGGCAGCTGCGGG - Intergenic
1054521158 9:66075647-66075669 CAGCCCATGAGGGCAGCTGCGGG - Intergenic
1054897293 9:70328597-70328619 CAGCCCATGAAAGCAGCTGTGGG - Intronic
1055915894 9:81399865-81399887 AAGGCATTTAAAGCAGCTCCTGG - Intergenic
1056827351 9:89885512-89885534 CAGGCAAAGAGAGCAGGGGCAGG - Intergenic
1056915314 9:90741015-90741037 CAGGTAATAAAAGCAGCTGGTGG + Intergenic
1057555980 9:96087675-96087697 CAGGCAAGGGAAGCCCCTGCTGG - Intergenic
1057677848 9:97149768-97149790 CAGTCCATGAGAGCAGCCGCGGG + Intergenic
1058287349 9:103195249-103195271 ATGCCAATGAAAGCAGCTTCTGG + Intergenic
1058309778 9:103485787-103485809 CAGCCTATGAAAGCAGGCGCAGG + Intergenic
1058337909 9:103855646-103855668 CAGGCAAGGAGAGCATGTGCAGG - Intergenic
1058722015 9:107772950-107772972 CAGCCCATGAAAGGAGCTGAGGG - Intergenic
1058961376 9:109995586-109995608 CAGGCAAAGAGAGCATGTGCAGG + Intronic
1062669946 9:137702580-137702602 CAGCCCATGAAAGCAGCTGCAGG - Intronic
1062740053 9:138167068-138167090 CAGCCCATGAGAGCAGCTGTGGG + Intergenic
1203370333 Un_KI270442v1:297791-297813 CAGCCCATGAGAGCAGCTGTGGG - Intergenic
1203546055 Un_KI270743v1:129206-129228 CAGCCCATGAGAGCAGCAGCAGG + Intergenic
1186912026 X:14178211-14178233 CAGCTAATGAAAACAGGTGCAGG - Intergenic
1187260871 X:17684076-17684098 CAGGCAAAGAGAGCATATGCAGG - Intronic
1187628670 X:21144084-21144106 CAGCCCATGAAAGCAGCTACAGG - Intergenic
1187945782 X:24425269-24425291 CAGGCAAAGAAGGGAGCTGAGGG + Intergenic
1189869722 X:45369350-45369372 CAGCCCATGAAACCAGCTGTTGG + Intergenic
1190499752 X:51062802-51062824 CAGCCTGTGAAAGCAGCTGTGGG + Intergenic
1190727048 X:53196657-53196679 CAGGGAAGGGAAGCAGCAGCTGG + Intronic
1190870279 X:54419164-54419186 CAGGAAATAAAGGGAGCTGCAGG - Intergenic
1191656579 X:63605157-63605179 CAGCCCATGAAAGCAACTGTGGG + Intergenic
1191873385 X:65769410-65769432 CAGTCCATGAAAGCAGCTGAGGG + Intergenic
1191923177 X:66279046-66279068 CAGCCAATGAGAGCAGCCACAGG - Intergenic
1191998985 X:67127564-67127586 CAGCCCATGAAAGCAGCTGGGGG + Intergenic
1192416841 X:70988674-70988696 TAAGCAATGAAAGCAGCTAGGGG + Intergenic
1193050701 X:77096434-77096456 CAGCCCATGAAAGCAGCCACAGG + Intergenic
1193175537 X:78388376-78388398 CAGCCTGTGAAAGCAGCTGTGGG - Intergenic
1193226016 X:78985350-78985372 CAGCCCATGAAAGCAGCCGTGGG - Intergenic
1194169530 X:90564529-90564551 CAGCCTATGAAAGTAGCTGCAGG + Intergenic
1194300642 X:92182057-92182079 CAGCCAGTAAAAGCAGCTGGAGG + Intronic
1194352651 X:92839887-92839909 CAGGCTGTGAAAGCAGCCACAGG - Intergenic
1194435119 X:93860270-93860292 CAGCCTATGAAAGCAGCCACAGG + Intergenic
1194855176 X:98919034-98919056 CAGCCCATGAGAGCAGCTGCAGG + Intergenic
1194864392 X:99048339-99048361 CAGCTCATGAAAGCAGCTGCAGG - Intergenic
1195822132 X:108956851-108956873 CAGCCCGTGAAAGCAGCTGTGGG + Intergenic
1196321922 X:114351287-114351309 CAGGCAAAAAAAGCATGTGCAGG - Intergenic
1196518264 X:116640138-116640160 CAGCTCATGAAAGCAGCTGATGG - Intergenic
1196601481 X:117605877-117605899 CAGACAGTGAAAGCAGCTGGGGG + Intergenic
1196829003 X:119761702-119761724 AAGGCCAGGAAAGCAGTTGCTGG + Intergenic
1197439935 X:126475768-126475790 CAGCCTGTGAAAGTAGCTGCTGG - Intergenic
1197595058 X:128454627-128454649 CAGCCTGTGAAAGCAGTTGCAGG - Intergenic
1198873787 X:141202171-141202193 CAGCCCAGGAAAGCAGCTGTCGG + Intergenic
1199250819 X:145659790-145659812 CAGCCCTTGAAAACAGCTGCAGG + Intergenic
1199338085 X:146642933-146642955 CAGCACATGAAAGCAGCTGCAGG + Intergenic
1199373815 X:147083739-147083761 CAGCCTGTGAAAGCAGCTACAGG + Intergenic
1199552461 X:149074553-149074575 CAAGCAATGTCAGCAGCTTCCGG + Intergenic
1199638970 X:149841630-149841652 CAGCCCGTGAAAGCAGCTGAGGG - Intergenic
1199823162 X:151471107-151471129 CAGCCCATGAAAGCAGCTGCAGG - Intergenic
1200104706 X:153705859-153705881 CAGGCCAGGCAAGCGGCTGCTGG + Intronic
1200395886 X:155987469-155987491 CAGCCCATGAAAGCAGCTGTGGG + Intergenic
1200515771 Y:4142303-4142325 CAGCCTATGAAAGTAGCTGCAGG + Intergenic
1200660956 Y:5956629-5956651 CAGGCTGTGAAAGCAGCCACAGG - Intergenic