ID: 907866956

View in Genome Browser
Species Human (GRCh38)
Location 1:58407730-58407752
Sequence TCTGATAGGAAGATATTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907866956_907866968 23 Left 907866956 1:58407730-58407752 CCCTGCAATATCTTCCTATCAGA 0: 1
1: 0
2: 1
3: 14
4: 182
Right 907866968 1:58407776-58407798 CCTGAAATCTACCCTCTCCATGG 0: 1
1: 0
2: 1
3: 17
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907866956 Original CRISPR TCTGATAGGAAGATATTGCA GGG (reversed) Intronic
902859816 1:19237078-19237100 TCTGATTGGAACACATTGGAAGG + Intronic
904481748 1:30798210-30798232 CCTGGTAGGAAAATATTACATGG + Intergenic
906445982 1:45898487-45898509 ACAGAACGGAAGATATTGCATGG - Intronic
906870136 1:49470337-49470359 TCTTATAGGAATATTTTACAAGG - Intronic
907827781 1:58035642-58035664 TGAGATAGCAAGATAGTGCATGG + Intronic
907866956 1:58407730-58407752 TCTGATAGGAAGATATTGCAGGG - Intronic
908597372 1:65702889-65702911 TCTAATTGGAAGACATTGCAAGG - Intergenic
908872967 1:68635610-68635632 TATGAAAAGAAGACATTGCATGG + Intergenic
908899992 1:68945629-68945651 TCTGGCAGGGAGAGATTGCAAGG - Intergenic
909351517 1:74659023-74659045 TCTGAAAGGAAAATATAACATGG + Intronic
910268817 1:85370275-85370297 TCTGATATCAAGGTATTGGAAGG - Intronic
911346145 1:96699058-96699080 TCTGATATGAAAATTTTGCTGGG - Intergenic
911452934 1:98088414-98088436 TATGAAAGGAAGTTATTACATGG + Intergenic
912015999 1:105036405-105036427 TCTGATATGAAGCTATTGAATGG - Intergenic
917654180 1:177109677-177109699 TGTGAAAGGAGGATATTCCATGG - Intronic
918277666 1:182969138-182969160 TTTGATGGGCAGATATTGCAGGG - Intergenic
922430110 1:225543055-225543077 ATTGATAGGAAGCCATTGCAGGG + Intronic
922464531 1:225838133-225838155 ACTGATCAGAAGATATTGCTGGG - Intronic
923939291 1:238802368-238802390 TCTGATAGCAAAATATTATAAGG + Intergenic
1064351740 10:14583346-14583368 TCGGAGATGAAGATACTGCAGGG + Intronic
1064568010 10:16663121-16663143 TCTGGTTGGAAGATATTTAAAGG - Intronic
1064676534 10:17765598-17765620 TCTGAAAGGGAGAAATTGGAAGG + Intronic
1064807461 10:19152248-19152270 GCTGATAGGAAGATAAATCAAGG + Intronic
1065343972 10:24730990-24731012 TCAGATAGGAAAAGATCGCAGGG + Intergenic
1066521378 10:36223807-36223829 TTTGGAAGGAACATATTGCAAGG + Intergenic
1067566228 10:47339792-47339814 TCTGACAGCAGGACATTGCAGGG - Intergenic
1067662177 10:48244351-48244373 TTTGAGAGGGAGATATTGTAGGG + Intronic
1068032698 10:51723130-51723152 TCTGAAAGGTAGATATGTCAAGG + Intronic
1069004649 10:63304101-63304123 TCTGATAGAAAGATACTGCCAGG - Intronic
1069275936 10:66590798-66590820 TCAGTTAGGAAGATATTTTATGG - Intronic
1070239349 10:74662574-74662596 TTTGATATGAAAATATTGCTGGG - Intronic
1073167449 10:101469216-101469238 TCTTACAGGAAAATATTGAATGG + Intronic
1077514963 11:2995991-2996013 CCTGACAGCAAGAGATTGCAGGG + Intergenic
1080919213 11:36692086-36692108 TCTGACATGGAAATATTGCAGGG - Intergenic
1085814423 11:79721704-79721726 TCTGATAGAACCATATTTCAAGG + Intergenic
1086439600 11:86814865-86814887 TCTGAGAGGCAGAAAGTGCAGGG + Intronic
1086966408 11:93032564-93032586 TCTAAAAGGAAGATAGGGCAAGG + Intergenic
1088436119 11:109814985-109815007 TCTGATGGGAAGCCATTGGAAGG + Intergenic
1088568384 11:111197091-111197113 TCTCAGAGGAAGAAATGGCATGG + Intergenic
1089326469 11:117660878-117660900 TGTGATAGGAAGATATTGAGGGG - Intronic
1090772941 11:129937817-129937839 TCTGCTGGAAAGGTATTGCAAGG - Intronic
1094778029 12:33754829-33754851 TCTCATGGGAAGCTATTTCATGG + Intergenic
1095581964 12:43810532-43810554 TCTGGTGGGAAGATGGTGCAAGG + Intergenic
1095879353 12:47115874-47115896 TCTGATCCAAAGATATTGTATGG + Intronic
1097048352 12:56204855-56204877 TCTGAGAGGAAGCCATTACATGG + Exonic
1097144965 12:56933800-56933822 TCTGATTGGAAGCCACTGCATGG - Intronic
1097245030 12:57603150-57603172 TCTGACAGGAAGATGTTATATGG - Exonic
1098630366 12:72714625-72714647 TCTTATAGGAATAAATTGTAAGG - Intergenic
1099422424 12:82478924-82478946 ATTTACAGGAAGATATTGCATGG + Exonic
1100690455 12:97033742-97033764 TCTGATAGGAACATATTGGTTGG + Intergenic
1106244977 13:27941330-27941352 CCTCACAGGAAGATACTGCATGG + Intergenic
1106413919 13:29530118-29530140 TCTAATAGGAAGGTATTTAAAGG + Intronic
1108239451 13:48446878-48446900 TGTGACAGGAAGCTCTTGCAGGG + Intronic
1109129578 13:58565144-58565166 TCTTATAGGAAGAAATTGAGAGG - Intergenic
1109928341 13:69178309-69178331 TTTAATGGGAAGATATAGCAGGG + Intergenic
1110545675 13:76752536-76752558 TAGGATAGGAAGCTATTACACGG - Intergenic
1112634650 13:101201915-101201937 TCTTATAGTAAGATATAACAGGG - Intronic
1113451006 13:110409727-110409749 TCTGGTGGAAAGATAATGCATGG - Intronic
1113813684 13:113157611-113157633 TGTGTTGGGAAGATATTGGAGGG - Intergenic
1114320777 14:21545554-21545576 TCTGAGAGGCAGAGGTTGCAGGG - Intergenic
1114875270 14:26709718-26709740 TCTGATAGGAGTATAATGTAAGG + Intergenic
1114982392 14:28181109-28181131 TCAGAAAGGAAGATAGTTCAGGG + Intergenic
1116476690 14:45348400-45348422 TTTGAAAGGAAGATATTAAATGG - Intergenic
1126171201 15:45696689-45696711 TCTGAGAGGCAGAGATTGCAGGG - Intergenic
1127025341 15:54798841-54798863 TATAAAAGGAAGATATTGCTGGG + Intergenic
1129128784 15:73471044-73471066 TGAGATAGGGAGCTATTGCAGGG + Intronic
1132007336 15:98240593-98240615 TCTGAAAGGAATATTTAGCATGG - Intergenic
1133943406 16:10328910-10328932 TCTGGGAGGCAGAGATTGCAGGG + Intronic
1136936513 16:34472050-34472072 TCTGAATGGAAGATGTTGAAAGG - Intergenic
1136963306 16:34876520-34876542 TCTGAATGGAAGATGTTGAAAGG + Intergenic
1140081594 16:71753306-71753328 TATGTTAGGAAGCCATTGCAGGG - Intronic
1143680366 17:8471717-8471739 TCTTATATGAAGCTATTGAAAGG - Intronic
1148926384 17:51089749-51089771 TCTGGTAGGCAGAGGTTGCAGGG - Intronic
1151347628 17:73511779-73511801 TCTGAAAGCAAGAGATGGCAGGG + Intronic
1203199188 17_KI270729v1_random:259948-259970 TGTAATAGAAAGATATTGAATGG + Intergenic
1203208788 17_KI270730v1_random:60688-60710 TGTAATAGAAAGATATTGAATGG + Intergenic
1153365266 18:4248689-4248711 TCTGAGAGGGAGAGATTGGAAGG - Intronic
1160121339 18:76133047-76133069 CCGGATAGGAAGATGTTGCCTGG + Intergenic
1160657330 19:280286-280308 CCTGATAGGAACATCCTGCAAGG + Intergenic
1167415358 19:49367837-49367859 TTTAAAATGAAGATATTGCATGG - Intronic
1168467565 19:56616406-56616428 TCTGAAAGGATGACATTGCTTGG - Intronic
926552188 2:14314171-14314193 TCTGATAGGAAGATAGTGCCTGG - Intergenic
927358744 2:22207213-22207235 TATGATGGGAAGCTATTGCCAGG - Intergenic
930242238 2:48947965-48947987 TCTAATAAGAAGATATAGAATGG - Intergenic
932914609 2:75842915-75842937 TGTGATATGAAGGTATTGGACGG + Intergenic
933058959 2:77711151-77711173 TCAGATAAGAAGATCATGCATGG - Intergenic
933457400 2:82534050-82534072 TCCATTAGAAAGATATTGCAGGG + Intergenic
942297490 2:174531925-174531947 TTTAATAGGAAAATATTGAAGGG - Intergenic
943290521 2:186065288-186065310 TACGATAGGAAGATATGGGAGGG + Intergenic
945059793 2:205899093-205899115 CATGAAAGGAAGATATTCCAGGG - Intergenic
945309842 2:208298916-208298938 TCTGAGAGGCAGAGGTTGCAGGG - Intronic
1169182748 20:3584351-3584373 TCAGATATGGAGATATTACATGG - Intronic
1170497793 20:16943783-16943805 TCTAATAAGAAGAGATTGCCAGG + Intergenic
1172569669 20:35960069-35960091 TCTGATAGCAAGAGCTTGGATGG + Intronic
1173982076 20:47232296-47232318 TCTGGGAGGAAGAGTTTGCAGGG + Intronic
1176526084 21:7919505-7919527 TGTAATAGAAAGATATTGAATGG - Intergenic
1177104051 21:16932537-16932559 TCTGATAGAAAGTGAATGCATGG - Intergenic
1177334863 21:19710182-19710204 TCTGAGAGGCACAGATTGCATGG - Intergenic
1177550687 21:22618238-22618260 TCTGAAAGGGAGATATTGGTAGG + Intergenic
1182807310 22:33084356-33084378 TCTGATAGAAATATAATGCAAGG + Intergenic
952422415 3:33144078-33144100 CCTGTTAGGAAGCTACTGCAAGG + Exonic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
957367740 3:79248542-79248564 TCTGATAGAAAGTTATTGAAAGG + Intronic
957913156 3:86649240-86649262 TCTGACAGGAAAATAGTGCTTGG + Intergenic
959426773 3:106199728-106199750 GTTTATAGGAAGATATTGTATGG + Intergenic
961055924 3:123788952-123788974 TCTGATAAGAATAAATTCCAGGG + Intronic
962819941 3:139038774-139038796 TCTGATGGGTGGATCTTGCAGGG - Intronic
964139552 3:153381356-153381378 TCTGATGGGTAGATATTGGCAGG + Intergenic
964242124 3:154607355-154607377 TCTGATGGAAAGAAATAGCAAGG - Intergenic
967261366 3:187645835-187645857 TCTAATAGGAAGAAATGTCAAGG + Intergenic
967794711 3:193587421-193587443 TCTCATAAGAATATATTGGATGG + Intronic
968360910 3:198146061-198146083 TATGATAGGGATTTATTGCAAGG - Intergenic
969617051 4:8259769-8259791 TTTAAAAGGAAGATACTGCAAGG + Intergenic
970376848 4:15467429-15467451 TATGAAATGAAGATGTTGCAGGG - Intergenic
970445896 4:16123119-16123141 TCTGAGATCAAGATGTTGCAGGG - Intergenic
976533630 4:86185492-86185514 TGAGATAGGAAGACATTGAAAGG + Intronic
976848159 4:89513685-89513707 GCAGATAGGAAGATATTTAAGGG + Intergenic
976894666 4:90094865-90094887 TCAAATATGAAGATATTTCATGG - Intergenic
980382221 4:132037107-132037129 TCTGAAAAGAAGTTATTGAATGG - Intergenic
980725301 4:136751213-136751235 TGTGATATGAAAATATTACATGG - Intergenic
981435655 4:144718471-144718493 TGAGATAAGAAGCTATTGCAGGG + Intronic
986107664 5:4675549-4675571 TCTGCTAGGAGGAAATTTCAAGG + Intergenic
986488968 5:8270024-8270046 TCTGCTAGGAAGAAATTTGAAGG - Intergenic
986961657 5:13220158-13220180 TCTGAAAGGAAGGTATTGATAGG - Intergenic
988878067 5:35470247-35470269 TCTCATAGGAGGATATTCTAAGG + Intergenic
988945719 5:36196236-36196258 TCTGTTAGGAATATATAGCTTGG - Intronic
989809177 5:45651921-45651943 TCAGATAGGATCATTTTGCAAGG - Intronic
989826543 5:45863537-45863559 TCTGATTGGAAGAAATTGATGGG + Intergenic
990484825 5:56247890-56247912 TCTGAGAGGAAGTCTTTGCAAGG + Intergenic
990911260 5:60854747-60854769 GCTGATAGGAAGCCATTGGAAGG - Intergenic
991094637 5:62726781-62726803 TATGTTAGGTAGATATTTCAAGG + Intergenic
991535816 5:67668438-67668460 GCAGATAGGAAGATATGGGAAGG + Intergenic
992225421 5:74615545-74615567 TCTGATAGGAATATCTTCCAGGG - Intergenic
992675497 5:79101954-79101976 TCTGATAGGAAGATAAGGAAAGG + Intronic
994201489 5:96981596-96981618 TCTGATGGGAAGAGATGGCTAGG + Intronic
994996375 5:107068440-107068462 TCTTATTGCAATATATTGCAAGG + Intergenic
995304824 5:110632386-110632408 TTTGATTGGAATATATTGCTGGG - Intronic
998599897 5:143574919-143574941 GGTGATAGGAAGCCATTGCAGGG - Intergenic
999019506 5:148148049-148148071 TCTTATATGAAGATGTTGAAGGG - Intergenic
1000905658 5:166963026-166963048 TTAAATAGGAAGATATTGAATGG - Intergenic
1004441285 6:15657523-15657545 TGTGATAGGAAGATAGGGGATGG - Intronic
1006828376 6:36953787-36953809 TCTGAGGGGAAGGTATTGGAAGG - Intronic
1007849911 6:44793049-44793071 TCTTTTAGGAAGATACTGTAGGG + Intergenic
1008326582 6:50189213-50189235 TCAAATAGACAGATATTGCAAGG + Intergenic
1014341559 6:120214151-120214173 TCTGATGAAAAGATATTTCAGGG - Intergenic
1017880273 6:158558088-158558110 TCTGACAGGAAGGAATTGCCAGG + Intronic
1018001468 6:159582223-159582245 TCAGATTGGGAGATATTTCAGGG + Intergenic
1019259100 7:70593-70615 TATGATAGGGATTTATTGCAAGG + Intergenic
1020836580 7:13160180-13160202 TCTGATAGGAATATTTTCAAAGG + Intergenic
1024864855 7:53893830-53893852 TATGATAGGAAGATTTTAAAAGG - Intergenic
1025557833 7:62331718-62331740 TCGGAATGGAAGATATTGAAAGG - Intergenic
1025985598 7:66448502-66448524 TCTGATAGAATAATCTTGCAGGG - Intergenic
1026002433 7:66571645-66571667 TCTGATAGAATAATCTTGCAGGG - Intergenic
1026029431 7:66777113-66777135 TCTGATAGAATTATCTTGCAGGG + Intronic
1026450693 7:70526592-70526614 TCTGGGAGGCAGAGATTGCAGGG + Intronic
1027208815 7:76127034-76127056 TCTGATAGAATAATCTTGCAGGG - Intergenic
1028047105 7:86135312-86135334 TCTTATACTAAGATATTTCATGG - Intergenic
1031992131 7:128205407-128205429 TCAGATGGGAAGATATTGGCAGG + Intergenic
1035889977 8:3332758-3332780 TCTGACGGGCAGATGTTGCAGGG + Intronic
1037521652 8:19685749-19685771 TCTGACAGGCAGGTATTTCAAGG + Intronic
1038845456 8:31225269-31225291 TCTGATAGCAATATATAGCAGGG + Intergenic
1039308588 8:36291585-36291607 TCTGTTAAGAACATATAGCAAGG - Intergenic
1039834239 8:41243768-41243790 TCTGATAGGAAGATGTTGGCAGG - Intergenic
1043395003 8:79827497-79827519 TCTCATAGGAAGATGTGGGAGGG - Intergenic
1044452217 8:92350188-92350210 TCTACTAGGAAAATGTTGCAAGG - Intergenic
1045760799 8:105604465-105604487 TGTGATGGGAAGCCATTGCATGG - Intronic
1046258413 8:111732051-111732073 TCTGATAGGTTTATATTTCATGG - Intergenic
1046642251 8:116745352-116745374 TTTGATATGAAGATAGTGAATGG - Intronic
1046721715 8:117627529-117627551 TCTAATAAGAATATAATGCAAGG + Intergenic
1048066968 8:130979996-130980018 TCTGAAAGGAAGGTATTGTCAGG + Intronic
1053659638 9:40259616-40259638 ACTTATGGGAAGATATTCCAAGG + Intronic
1053910009 9:42888968-42888990 ACTTATGGGAAGATATTCCAAGG + Intergenic
1054371766 9:64405915-64405937 ACTTATGGGAAGATATTCCAAGG + Intronic
1054524960 9:66116600-66116622 ACTTATGGGAAGATATTCCAAGG - Intronic
1054679385 9:67895632-67895654 ACTTATGGGAAGATATTCCAAGG + Intronic
1054943431 9:70769131-70769153 TGTGATGGAAAGCTATTGCAGGG - Intronic
1055473432 9:76637045-76637067 CCTGGTAGGAAGATATAGAATGG + Intronic
1058433032 9:104935897-104935919 TCTGAAAACAAGATATTGGAAGG + Intergenic
1059108792 9:111535066-111535088 TCTGATAGGTAACTATGGCAAGG - Intronic
1059223604 9:112650352-112650374 TCTCATAACAATATATTGCAAGG + Intronic
1061443429 9:130622938-130622960 TCTGGTAGCAGGATGTTGCAAGG - Intronic
1062745615 9:138209892-138209914 TATGATAGGGATTTATTGCAAGG - Intergenic
1185523865 X:761862-761884 TCTGAGATGAAGATATCTCAGGG + Intergenic
1186842385 X:13497055-13497077 TCTGGAAGGATGATATTGCCTGG - Intergenic
1187424222 X:19162595-19162617 TATGACAGGAAGTTATAGCATGG + Intergenic
1189739154 X:44100786-44100808 TCTGAGAGGAGGGTTTTGCAGGG + Intergenic
1191817518 X:65263656-65263678 AGTGATAGCAAGATATTACAGGG + Intergenic
1192591619 X:72364769-72364791 TCTTATATGCATATATTGCATGG - Intronic
1194403555 X:93467433-93467455 TCTGAAAGGTAGATTTTGGATGG - Intergenic
1194767601 X:97860281-97860303 CTTGACAGGAAGAAATTGCATGG - Intergenic
1194888701 X:99350940-99350962 TCTGATATGAAAATCTGGCAAGG - Intergenic
1197165059 X:123368142-123368164 TCTGATAGGCAGATGCTTCATGG + Intronic
1198632883 X:138661266-138661288 TCTGAGAGGAAGATCTTTGAGGG - Intronic
1198800377 X:140441713-140441735 AGTGAGGGGAAGATATTGCAAGG - Intergenic
1199661783 X:150058107-150058129 ACAGATAGGAAGATATTCCAGGG + Intergenic
1200169748 X:154063986-154064008 TCTGAAATCAAGATGTTGCAGGG - Intronic
1201200174 Y:11532669-11532691 TCGAATAGAAAGATATTGAATGG + Intergenic
1201217908 Y:11739272-11739294 TGTAATAGAAAGATATTGAATGG + Intergenic