ID: 907870469

View in Genome Browser
Species Human (GRCh38)
Location 1:58438324-58438346
Sequence TGGGCCTAATCAAGTCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907870469 Original CRISPR TGGGCCTAATCAAGTCTTGA GGG Intronic
903654150 1:24938724-24938746 AGGGCCTAATCCATTCATGAGGG - Intronic
904754232 1:32759354-32759376 TGGGGATAATCATGCCTTGAAGG + Intronic
905005479 1:34706248-34706270 TGGCCCTAATGAAGTCTCTAGGG + Intergenic
905319417 1:37105399-37105421 TGGGAATAATCCAGTCATGATGG + Intergenic
907870469 1:58438324-58438346 TGGGCCTAATCAAGTCTTGAGGG + Intronic
912367311 1:109145079-109145101 TCGGCCTAATCACCTCTTAAAGG - Intronic
915645183 1:157265502-157265524 TGGGCCAAGTCACGGCTTGATGG - Intergenic
917526897 1:175796201-175796223 AGGGCATATTCAAATCTTGAGGG + Intergenic
923265849 1:232313349-232313371 CTGGCCTAATCACTTCTTGAAGG - Intergenic
1066673406 10:37863104-37863126 TGGTCTTAATCCAGTCATGAGGG - Intergenic
1071016736 10:81006195-81006217 TGGGCATAATCAAGGGTAGAAGG - Intergenic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1076772606 10:132674624-132674646 TGGGCTTGATTAAGTCCTGAAGG - Intronic
1078092690 11:8277102-8277124 GAGGCCTAACCTAGTCTTGAGGG - Intergenic
1078745140 11:14106455-14106477 TTGGCATAAACAATTCTTGAGGG - Intronic
1080308826 11:30866479-30866501 AGGGGCTAATTAAGTCATGAGGG - Intronic
1087273321 11:96135090-96135112 TGTGCCTAATCACCTCTTAATGG - Intronic
1087995383 11:104800343-104800365 AGGGCCTCATCATGTCTTGCTGG - Intergenic
1089490520 11:118880585-118880607 TGGGTCTATCCAAGTCCTGATGG - Intergenic
1090155199 11:124430112-124430134 TGGGCCCTACCAAGTCTTCAAGG + Intergenic
1090575151 11:128094381-128094403 TGGGGCTAAGCAGGTCCTGAAGG + Intergenic
1092931080 12:13316511-13316533 TGGGCCAAAGCAAATATTGATGG - Intergenic
1093036360 12:14335873-14335895 TGGGCTCAAGCAGGTCTTGAAGG + Intergenic
1097586025 12:61517168-61517190 TGGGCCTAATCAACTGTCCAAGG - Intergenic
1098854027 12:75631851-75631873 TTGGCCTAATCACCTCTTAAAGG + Intergenic
1101334207 12:103781880-103781902 TGGGCATAATCAGCTCTTTAGGG + Intronic
1101924198 12:108957592-108957614 TGGGGCTTATTAAGTCTTAATGG - Intronic
1102535756 12:113579743-113579765 AGGGCCTGATGAAGTCTAGATGG + Intergenic
1105481141 13:20776860-20776882 TTGGCCTAATCACCTCTTAAAGG - Intergenic
1106220481 13:27742604-27742626 TGGGGCTAATGAAGGCCTGATGG - Intergenic
1108460529 13:50662697-50662719 TGGGCCTAAAACAGTCTAGATGG + Intronic
1108719401 13:53115666-53115688 TTGGCCTAATCACCTCTTAAAGG - Intergenic
1109064807 13:57673328-57673350 AAGGCCTACTCAAGACTTGATGG + Intronic
1115863636 14:37717882-37717904 AGGGCCTAATCACCTCTTAAAGG - Intronic
1116555164 14:46293537-46293559 TGGGCTTAATCAGGTCCAGAAGG - Intergenic
1120994168 14:90402965-90402987 TGAGGCTAAAAAAGTCTTGAAGG + Intronic
1123124876 14:105939146-105939168 TTGGCCTAGTCTAATCTTGAAGG - Intergenic
1127703736 15:61527180-61527202 TGTGTCAAATCAAGTCTTTATGG + Intergenic
1128704898 15:69831821-69831843 TGGGCCTGATTAGGTCGTGAGGG - Intergenic
1128725351 15:69983858-69983880 TTGGCCTAATCCAGACTTAAGGG - Intergenic
1130706894 15:86241692-86241714 CTGGCCTAATCATGTCTTCAAGG + Intronic
1131949047 15:97660896-97660918 TTGACCTAATCATGTCTTAAAGG - Intergenic
1132328228 15:100989701-100989723 TTGGCCTAATCACCTCTTAATGG + Intronic
1136776115 16:32872774-32872796 AGGGCCTGATCAGGTCTTGAAGG + Intergenic
1136894500 16:33988738-33988760 AGGGCCTGATCAGGTCTTGAAGG - Intergenic
1203078531 16_KI270728v1_random:1134883-1134905 AGGGCCTGATCAGGTCTTGAAGG + Intergenic
1148919607 17:51019002-51019024 ATGGCCTAATCACCTCTTGAAGG - Intronic
1153638991 18:7138765-7138787 GGGCCCTAATCAATTCATGAGGG - Intergenic
1156148308 18:34213240-34213262 AGGACCTAATCACCTCTTGAAGG - Intronic
1156582573 18:38394650-38394672 TGGGCTCAAGCAAGTCCTGAAGG + Intergenic
1156606394 18:38671950-38671972 TGGGCTTGAGCAGGTCTTGAAGG + Intergenic
1164263218 19:23587415-23587437 ATGGCCTAATCAATTCTTAAAGG + Intronic
1164403795 19:27923793-27923815 TGGGCATAAAAAAGTCTGGAGGG - Intergenic
1164427683 19:28156951-28156973 TGGGCCTCATGCAGTCTTGTGGG + Intergenic
1164549909 19:29201277-29201299 TGGACCTAATCACCTCTTTAAGG - Intergenic
1164855465 19:31517463-31517485 AGGGCCTAATCAACTAATGATGG - Intergenic
1166069740 19:40380142-40380164 TGAGCCTTATCATATCTTGACGG + Intronic
927084206 2:19658324-19658346 ATGGCCTAATCATGTCTTAAAGG + Intergenic
928401261 2:30980283-30980305 TGGGCCAAAGCAGGTCTGGAAGG - Intronic
929109156 2:38391923-38391945 TGGACACAATCTAGTCTTGAGGG + Intergenic
932958190 2:76380849-76380871 ATGGCCTAATCAACTCTTAAAGG + Intergenic
935764394 2:106351186-106351208 ATGGCCTAATCACCTCTTGAAGG - Intergenic
939523657 2:143264127-143264149 TTGGCCTAAACAGGTCTAGAGGG - Intronic
939751035 2:146046214-146046236 TGGATCTAAACAAGTCTTGATGG - Intergenic
943098456 2:183457543-183457565 AGGGCCTGATCTAGTCTTTAAGG - Intergenic
944879740 2:204000467-204000489 TGTGCAAGATCAAGTCTTGATGG + Intergenic
947468068 2:230371905-230371927 TGGGCCCAATCTAATCTTGTAGG + Intronic
1169205913 20:3740318-3740340 TGGTTCTAATCAGGACTTGAGGG - Intronic
1170031094 20:11944943-11944965 TTGGCCAAAGCAAGTCGTGAGGG + Intergenic
1170761294 20:19253701-19253723 TGGGCCTAACCCAGTCTGGCAGG + Intronic
1173906595 20:46634237-46634259 GGGGGCTAATTCAGTCTTGAGGG + Intronic
949575566 3:5335724-5335746 TGTGACAAATCAAGTCTTAAAGG + Intergenic
949779404 3:7669249-7669271 TGGGCATAATTTAGACTTGAAGG + Intronic
953355244 3:42250730-42250752 GGGGTTTATTCAAGTCTTGAAGG - Intergenic
953879189 3:46682929-46682951 TGTGCCAAATAAAGTCTTGATGG - Intronic
961615904 3:128180874-128180896 GGGGGCTAATGAAGTCCTGAAGG + Intronic
962084668 3:132177905-132177927 TGGGACTAATGAAATCTAGATGG + Intronic
965251316 3:166348081-166348103 TGGGCTCAAGCAAGTCTTGAAGG - Intergenic
971520808 4:27547760-27547782 TTGGCCTAATCACCTCTTAAAGG + Intergenic
974024551 4:56721907-56721929 TGGACCTAATCACCTCTTAAAGG - Intergenic
974294730 4:59982491-59982513 CGGCCCTAATCACCTCTTGAAGG + Intergenic
975225424 4:71865725-71865747 TTGGCCTGATCCAGTCTTTAGGG + Intergenic
979543918 4:121918050-121918072 ATGGCCTAATCACCTCTTGAAGG - Intronic
981936986 4:150249325-150249347 TGGGCCTACTCTAGTCCTGAGGG + Intronic
984244112 4:177254080-177254102 ATGGCCTAATCACTTCTTGAAGG - Intergenic
991368185 5:65890860-65890882 TGAACCTAATCAAGTCTCTAGGG + Intergenic
992810448 5:80382479-80382501 AGGGCCTAATCACCTCCTGAAGG + Intergenic
993108352 5:83625730-83625752 TGGGCTTAGACAGGTCTTGAAGG + Intergenic
999080413 5:148838332-148838354 TAGGCCTAAGCCAGTCTTGGAGG + Intergenic
999408656 5:151329967-151329989 TGTGCCTACTCAAGTCCTGCAGG - Intronic
999441004 5:151600815-151600837 TTGGCCTAATCAACTCCTAAAGG - Intergenic
1001903174 5:175447726-175447748 TTGGCCTAATCACCTCTTAAAGG - Intergenic
1006757824 6:36432137-36432159 TGGACCTAACCTAGTCTAGATGG + Intronic
1018397368 6:163388664-163388686 TGGGCTTCAACCAGTCTTGAAGG + Intergenic
1020359162 7:7308626-7308648 TGGGCATAACCAAGTCTACATGG - Intergenic
1020725486 7:11808242-11808264 TGAGCCTAATCACCTCTTAAAGG - Intronic
1021980771 7:26053230-26053252 ATGGCCTAATCACCTCTTGATGG - Intergenic
1022804000 7:33803627-33803649 AGGGACTAATCAAGTTTTCAGGG - Intergenic
1024122585 7:46260251-46260273 GGGGCCTGATCCAGTCTGGAAGG - Intergenic
1024392641 7:48832764-48832786 TTGTCCTAATCATCTCTTGAAGG + Intergenic
1024884321 7:54124458-54124480 TGGGCTTGAGCAAGTCCTGAAGG - Intergenic
1025855717 7:65275831-65275853 CAGGCCTAATCAATTCTTAAAGG + Intergenic
1031628785 7:124021310-124021332 TGGGCCTGAGCAAGCCCTGAAGG + Intergenic
1031761975 7:125724582-125724604 TTGCCCAAAGCAAGTCTTGAGGG + Intergenic
1031801916 7:126257567-126257589 TGGGCTTAATCAAATCTAAATGG + Intergenic
1040830822 8:51675238-51675260 GTGGCCTAATCATGTCTTAAAGG - Intronic
1042254376 8:66788206-66788228 TGGGCTTAAGCAGGTCTGGACGG - Intronic
1044018817 8:87078644-87078666 AGGGACTAATAGAGTCTTGATGG + Intronic
1048218013 8:132514388-132514410 TTGACCTAATCAAATCTTCAAGG + Intergenic
1055752848 9:79526727-79526749 TTGGCCTAATCACCTCTTAAAGG - Intergenic
1060739284 9:126087654-126087676 ATGGCCTAATCACGTCTTAAAGG + Intergenic
1062135492 9:134925201-134925223 TGGGCTTGATCAAGTACTGAAGG + Intergenic
1185498619 X:580287-580309 TGGTCCTAAACCACTCTTGAGGG + Intergenic
1186801054 X:13092700-13092722 TGTGCCCAACCAAGACTTGAGGG - Intergenic
1187573412 X:20529211-20529233 TGGCCATCATCAAGACTTGAAGG + Intergenic
1187944625 X:24414309-24414331 ATGGCCTAATCACCTCTTGAAGG - Intergenic
1188764507 X:34075412-34075434 TGGGCCTGAGCAGGTCCTGAAGG + Intergenic
1190298842 X:49044133-49044155 TGTGCTTAATAAATTCTTGACGG + Intergenic
1192531667 X:71892956-71892978 TGGGCTTAAGCAGGTCCTGAAGG - Intergenic
1192802788 X:74483353-74483375 TGGGTCTTCTCAAGTCTTCAAGG + Intronic
1194013512 X:88590597-88590619 AGGGCCTACTCAAGGCCTGAGGG + Intergenic
1194232886 X:91346471-91346493 TGGGCTTAAGCAGGTCCTGAAGG + Intergenic
1197966128 X:132063953-132063975 GGGACCTAATTAAGTCATGAAGG + Intergenic
1199310405 X:146314215-146314237 TGGGCTTGATCAGGTCCTGAAGG - Intergenic
1200103763 X:153701269-153701291 AGGGTCTGATCAGGTCTTGAAGG - Intronic
1200275818 X:154731325-154731347 TGGAGGTAATCAAGTCTGGATGG + Intronic
1201398904 Y:13581455-13581477 CGGGCCCAAGCAAGCCTTGAAGG + Intergenic