ID: 907871376

View in Genome Browser
Species Human (GRCh38)
Location 1:58446521-58446543
Sequence CAGTCAAAAGGGCTGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 391}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907871367_907871376 1 Left 907871367 1:58446497-58446519 CCTTCCTATTTACTGAGCAAAGT No data
Right 907871376 1:58446521-58446543 CAGTCAAAAGGGCTGGGGGTGGG 0: 1
1: 0
2: 4
3: 43
4: 391
907871364_907871376 28 Left 907871364 1:58446470-58446492 CCAGTTGATTTATTTATAATGCA 0: 1
1: 0
2: 3
3: 50
4: 371
Right 907871376 1:58446521-58446543 CAGTCAAAAGGGCTGGGGGTGGG 0: 1
1: 0
2: 4
3: 43
4: 391
907871368_907871376 -3 Left 907871368 1:58446501-58446523 CCTATTTACTGAGCAAAGTACAG 0: 1
1: 1
2: 0
3: 15
4: 203
Right 907871376 1:58446521-58446543 CAGTCAAAAGGGCTGGGGGTGGG 0: 1
1: 0
2: 4
3: 43
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907871376 Original CRISPR CAGTCAAAAGGGCTGGGGGT GGG Intronic
900126428 1:1070825-1070847 CAGCCAGAGGGGCTGGGAGTTGG + Intergenic
900342617 1:2195898-2195920 AAGTCGAAGGGCCTGGGGGTTGG - Intronic
900427537 1:2587368-2587390 CAGACAGAAGGGCCGGGGTTGGG - Intronic
900832195 1:4973290-4973312 GACTCGAAAGGCCTGGGGGTGGG - Intergenic
901717401 1:11167546-11167568 CACTCAACAGGTCTGAGGGTAGG + Intronic
902450668 1:16494870-16494892 CAGTCCTAAGGGTTGGGGGAAGG + Intergenic
903426194 1:23256233-23256255 GAGAAAAAAGGGCTGGGGGAAGG - Intergenic
903732058 1:25503848-25503870 CATTCATGAGGTCTGGGGGTGGG + Intergenic
906324972 1:44839820-44839842 GAGTCTGCAGGGCTGGGGGTAGG + Intronic
906731130 1:48082093-48082115 CAGTGAAATAGGCTGGGGTTTGG + Intergenic
906767145 1:48443940-48443962 CAGTCAAAAGGCCAGTGGGTCGG - Intronic
907871376 1:58446521-58446543 CAGTCAAAAGGGCTGGGGGTGGG + Intronic
909173352 1:72322489-72322511 CAGCCATGAGGGGTGGGGGTGGG - Intergenic
912913232 1:113784487-113784509 CACGGAAAAGGGCAGGGGGTTGG + Intronic
915028839 1:152858742-152858764 CAGAGAAAAGGGCTAGGGATAGG + Intergenic
915036905 1:152935383-152935405 CAGACATAAGAGCTGGGGTTTGG - Intergenic
915899991 1:159840013-159840035 CACTCACAAGGGCTAGGGGCTGG + Intronic
916166310 1:161969895-161969917 CAGTCAGAATGTCTGGGGGTGGG - Intergenic
916211467 1:162363445-162363467 AACTCAAAAGGACTGGGTGTGGG - Intronic
917525105 1:175781474-175781496 CAGAGAAAGGGACTGGGGGTAGG - Intergenic
917854198 1:179088108-179088130 TAGTCAGGAGGGCTGGGGGAGGG + Intronic
918766357 1:188489544-188489566 CAGGCCAAAGGCATGGGGGTTGG + Intergenic
920282415 1:204854089-204854111 CAGGCAAAAAGGCTGGTGGGTGG - Intronic
920503087 1:206497671-206497693 CACTCTAAAGGCCTGGGGGAAGG + Exonic
920505619 1:206513419-206513441 CCCTCAGAAGGGCTGGGGGTGGG - Intronic
923218892 1:231875275-231875297 CACTCACCAGGGCTGGGGGCTGG - Intronic
924154300 1:241160292-241160314 CAGTCCAAAGAGCTCTGGGTAGG + Intronic
924164265 1:241265542-241265564 CAGGCAAGACGGCTGGGGCTGGG + Intronic
924507650 1:244701225-244701247 CAGTTAAAAGGGCGGGGGGGGGG - Intronic
1062802573 10:390974-390996 CAAGCAGCAGGGCTGGGGGTTGG - Intronic
1063822042 10:9846914-9846936 CAGTATAAAGGCCTTGGGGTGGG - Intergenic
1064123324 10:12638157-12638179 CAATGAAAAGGGCTAGGGGGTGG + Intronic
1064178004 10:13091992-13092014 CAGTGAAAAGGGCTGATGGTGGG + Intronic
1064479506 10:15725410-15725432 CAGTGCAAAGGGTGGGGGGTGGG + Intergenic
1064886269 10:20115869-20115891 CAGTCAAGATGGCTGAAGGTAGG - Intronic
1068061386 10:52072055-52072077 GAGTCATAAGGGCTGGGTGAAGG - Intronic
1068440894 10:57053670-57053692 CAGTGATACTGGCTGGGGGTGGG - Intergenic
1069819307 10:71217695-71217717 GAAACAAAAGGGGTGGGGGTGGG - Intronic
1069994508 10:72334303-72334325 CAGTGGGAAGGGCTGGGGGAGGG - Exonic
1070659339 10:78293550-78293572 CAGTCAAAGGGGGAGGGGGTGGG - Intergenic
1072430748 10:95368814-95368836 CAGCCAAAAGGGCTGGAGGATGG - Intronic
1073049967 10:100661044-100661066 AAGTCAAAAGGGATGCGTGTGGG + Intergenic
1073167384 10:101468385-101468407 CATTAAAAAAGGCGGGGGGTGGG + Intronic
1073470386 10:103718473-103718495 CAGGGCAAAGGGCTGGGGGCTGG + Intronic
1073709651 10:106022142-106022164 TAGAGAAAAGGGGTGGGGGTGGG + Intergenic
1075146896 10:119890146-119890168 CAGTCAAAGGGCCAGCGGGTTGG - Intronic
1075483286 10:122800136-122800158 TGGGCAAAAGGGCTGGGGGCAGG + Intergenic
1076769964 10:132657483-132657505 CAGACTACAGAGCTGGGGGTGGG - Intronic
1077409828 11:2398776-2398798 CAGTGAGATGGGCTTGGGGTAGG + Intergenic
1077899242 11:6476409-6476431 AAGTCAAAAGAGCTGGGGCCAGG - Exonic
1077994563 11:7442198-7442220 CAGTGAAAATGGCTGAGGGGAGG + Intronic
1078252504 11:9627942-9627964 CATTCAAGAGTGTTGGGGGTAGG - Intergenic
1079138593 11:17792410-17792432 CCGTCAGCAGGGATGGGGGTGGG + Intronic
1079527940 11:21413334-21413356 CACTCAAGGGTGCTGGGGGTGGG + Intronic
1081927028 11:46839241-46839263 CAGTAATACAGGCTGGGGGTAGG + Intronic
1082784361 11:57308791-57308813 GAGTCCAAAGAGCTTGGGGTGGG - Exonic
1082869622 11:57932050-57932072 CAGGTAAGTGGGCTGGGGGTGGG - Intergenic
1083279740 11:61619497-61619519 CATTAAAAAGGGCAGGGGGTGGG - Intergenic
1083336644 11:61925691-61925713 CAGGTAAAAGGCCTGGAGGTGGG + Intergenic
1083647957 11:64184067-64184089 CAGTGCAAAGGGCCTGGGGTGGG - Intergenic
1084584368 11:70048713-70048735 CAGTAACCAGGGCTGGGGGGTGG - Intergenic
1084587067 11:70068519-70068541 CAGTGGAAGGGGCTGGGAGTGGG + Intergenic
1084733154 11:71087408-71087430 CTGGCAAAAGGGCTGGCGGCTGG + Intronic
1085462913 11:76706043-76706065 AAGTCAAAAGGCCTGGGTTTCGG - Intergenic
1088645155 11:111912012-111912034 CAGAGAACAGGGGTGGGGGTGGG - Intronic
1090908856 11:131100802-131100824 CAGGCAAGAGGGTTGGGAGTAGG + Intergenic
1091079691 11:132654836-132654858 CAGTCAGGATGGGTGGGGGTGGG - Intronic
1091661848 12:2390159-2390181 TAGTCATAAGGGCTGGGCTTGGG - Intronic
1091818901 12:3459700-3459722 CAGGGAGAAGGGCAGGGGGTTGG + Intronic
1092097987 12:5860080-5860102 CAGTGAGAAGGGCTGGGTGCTGG - Intronic
1092880286 12:12882650-12882672 AAGTCAAAAGGGATAGGGGTGGG - Intergenic
1095353318 12:41241033-41241055 GAGCTAAAAGAGCTGGGGGTTGG - Intronic
1095499971 12:42827285-42827307 CAGTAGAAAGGGTTGTGGGTAGG + Intergenic
1096865320 12:54559255-54559277 AAGAGAAAAGGGGTGGGGGTGGG - Intronic
1097101957 12:56596246-56596268 GAAGCAAAAGGGCAGGGGGTGGG + Exonic
1097182320 12:57178550-57178572 CAGGTCAAAGGGCTGGGTGTTGG - Exonic
1099165945 12:79307602-79307624 TGGTCGGAAGGGCTGGGGGTGGG + Intronic
1100107632 12:91196182-91196204 CAGTCAAAAGAGCTTGGGCAGGG + Intergenic
1100860743 12:98803697-98803719 CTGGGAACAGGGCTGGGGGTGGG + Intronic
1101686696 12:107030914-107030936 AACTCAGAAGAGCTGGGGGTTGG + Intronic
1101889515 12:108700226-108700248 CAGTGATAAGGGCTGGGTGCTGG - Intronic
1103273014 12:119689001-119689023 AAATAAAAAGGGCCGGGGGTGGG + Intronic
1103965158 12:124634078-124634100 CAGTCAGAGGGGCTGGTGGCTGG + Intergenic
1104306866 12:127617542-127617564 CAGTCAAAGGGCCAGTGGGTTGG - Intergenic
1104573577 12:129946254-129946276 CAGTCACAGGTTCTGGGGGTTGG + Intergenic
1105980902 13:25515195-25515217 CAGTCCAAAGGCCGGTGGGTTGG - Intronic
1106323033 13:28659600-28659622 CAGTTACAAGGGCGGGGGCTGGG - Intronic
1106467435 13:30025356-30025378 CATGCAGCAGGGCTGGGGGTAGG + Intergenic
1106578642 13:30999161-30999183 CCGGTAAAAGGGCTGGGGATGGG + Intergenic
1107399258 13:40053140-40053162 CTGACAGAAGGGGTGGGGGTTGG - Intergenic
1107825091 13:44321883-44321905 CAGTCAGAAGGCCTGAGAGTAGG + Intergenic
1109024834 13:57143601-57143623 CAGACAAAAGGTGTTGGGGTGGG + Exonic
1109025821 13:57150171-57150193 CAGACAAAAGGTGTTGGGGTGGG + Exonic
1109026811 13:57156744-57156766 CAGACAAAAGGTGTTGGGGTGGG + Exonic
1109027803 13:57163315-57163337 CAGACAAAAGGTGTTGGGGTGGG + Exonic
1109028789 13:57169880-57169902 CAGACAAAAGGTGTTGGGGTGGG + Exonic
1110561654 13:76916446-76916468 CAGAGAAATGGGCTGGGAGTGGG - Intergenic
1110868919 13:80427791-80427813 CAAGAAAAAGGGCTGAGGGTTGG + Intergenic
1111197108 13:84889147-84889169 CAAACAAAAAGGCTGGGAGTGGG + Intergenic
1112508513 13:99989581-99989603 GAGACAAAAGGGCTAGGGGGTGG - Intergenic
1113080056 13:106509984-106510006 CTGTCATAAGGGCTGGGTGGAGG - Intronic
1113576108 13:111396357-111396379 CACTCTAAAGTACTGGGGGTTGG - Intergenic
1113740935 13:112711972-112711994 CAGACAACAGGGCTGGGAGAAGG - Intronic
1114058009 14:18991720-18991742 CAATCAGAAGGGCTGGGGCAGGG - Intronic
1114104539 14:19410034-19410056 CAATCAGAAGGGCTGGGGCAGGG + Intronic
1114267470 14:21081481-21081503 AAGTCAAAGGGGTTGGGGATGGG - Intronic
1117224967 14:53647226-53647248 CAGTCAAAGGGGCAGGGGCTTGG - Intergenic
1118312749 14:64705294-64705316 CAAACCAAAGGGCTGGGTGTAGG - Intronic
1118320070 14:64747809-64747831 CAGTCAAGCGGGTCGGGGGTGGG - Exonic
1119081759 14:71701167-71701189 CAGTCATATTGGATGGGGGTTGG + Intronic
1120177850 14:81314244-81314266 TAGTCAAAAGGGCACTGGGTTGG - Intronic
1121406706 14:93723359-93723381 CAGTCAGAAGGGCTGGTGCCTGG + Intronic
1121752687 14:96370670-96370692 CAGTCAGAAAGGGTGGAGGTGGG - Intronic
1122286381 14:100655071-100655093 CAGCCACAGGGCCTGGGGGTGGG + Intergenic
1122885241 14:104707770-104707792 CAGGCAGCAGGGGTGGGGGTGGG - Exonic
1124891658 15:33739317-33739339 CAGTCAAATGGCATGGGGTTGGG - Intronic
1125296584 15:38209611-38209633 AAGTCTAAGGGGCTGGAGGTGGG + Intergenic
1125874981 15:43136033-43136055 CAGAAAAAAGGACTGGGGGATGG - Intronic
1127381634 15:58435464-58435486 CAGTCAAATGGGGTGGGAGTGGG + Intronic
1128307056 15:66605581-66605603 AAGGCAGAAGGGCTGGGGATGGG - Intronic
1128427783 15:67559798-67559820 CCAACAAAAGGGGTGGGGGTAGG - Intronic
1128467891 15:67928154-67928176 CTGCCGAGAGGGCTGGGGGTGGG + Intergenic
1131029162 15:89171865-89171887 AAGTCAGAACGTCTGGGGGTGGG - Intronic
1131034222 15:89210650-89210672 GAGACAAGAGGGCTGAGGGTGGG - Intronic
1132252700 15:100346147-100346169 CAGTGAAAAGGGATAGGGGAGGG - Intergenic
1132500231 16:281735-281757 CAGCCAGGAGGACTGGGGGTGGG - Exonic
1132693532 16:1192214-1192236 CAGTCACAAAGGCTTGGGGTGGG + Intronic
1133436501 16:5784621-5784643 TAATCAACAGGGCTGGAGGTGGG - Intergenic
1134071904 16:11265473-11265495 CAGACAAAAGGACTGGGGAATGG - Intronic
1135769594 16:25207079-25207101 CAGTTACTGGGGCTGGGGGTTGG - Intergenic
1135972703 16:27084133-27084155 CAATCAGACGGGCCGGGGGTGGG + Intergenic
1136369838 16:29829563-29829585 AAGTCCAAAGTGCTGGGGGCAGG + Intronic
1138813893 16:60182392-60182414 CTAGCACAAGGGCTGGGGGTGGG - Intergenic
1140745758 16:77978848-77978870 CAGTCAAATTGCATGGGGGTGGG - Exonic
1143751688 17:9032740-9032762 CTGGCCAAAGGGCTGAGGGTAGG - Intronic
1144833053 17:18142430-18142452 CAGTCACAAGGGCCTGGGGTTGG - Intronic
1145171499 17:20661563-20661585 CAATCGAAAGGCCTGGGGCTGGG + Intergenic
1145804986 17:27720308-27720330 CAGTCAAAAGGCCAGTGGGTCGG - Intergenic
1146265291 17:31448829-31448851 GAGTCAAACGGGCTGAGTGTGGG + Intronic
1147257196 17:39188697-39188719 GAATGAAAAGGGTTGGGGGTGGG + Intronic
1147334942 17:39721732-39721754 CAGTCAGAATCTCTGGGGGTGGG + Intronic
1147563093 17:41520863-41520885 CAGCCAGCAAGGCTGGGGGTGGG + Exonic
1148550327 17:48546479-48546501 CCTTAAAAAGGCCTGGGGGTGGG + Intergenic
1151592087 17:75052019-75052041 CCCTCAAAAGGACTGGGGGTGGG - Intronic
1151758369 17:76087431-76087453 CGGTCAAAGGGGCTGAGGGAGGG + Intronic
1151875158 17:76863873-76863895 CAGTGAAAAGGGATGGGGTTTGG - Intergenic
1151875349 17:76864969-76864991 CAGTGAAGAGGGATGGGGTTTGG + Intergenic
1151995201 17:77603949-77603971 CAGACTACAGGGGTGGGGGTGGG + Intergenic
1152039624 17:77894451-77894473 AAGGCAAAAGGGCTGGGCCTGGG + Intergenic
1152100592 17:78299579-78299601 CTGGCAAAAGAGCAGGGGGTTGG - Intergenic
1152154904 17:78626625-78626647 CATTCACAGGGGCTGGGGTTAGG - Intergenic
1152212845 17:79012093-79012115 CAGCCACAAGGGCTGCTGGTTGG - Intergenic
1152315089 17:79575443-79575465 CAGCCAGCAGGGCTGGGGGACGG + Intergenic
1152560104 17:81073656-81073678 CAGTGAAAAAGACTGGGGGAGGG - Intronic
1152820603 17:82435875-82435897 CGGCCAACAGGGCTGGGGGAGGG + Intronic
1153572366 18:6486128-6486150 CAGTACAGAGGGCTGGGGGTGGG - Intergenic
1155090863 18:22509491-22509513 TATTAAAAAGTGCTGGGGGTGGG - Intergenic
1155231039 18:23775477-23775499 CAGTCAGAGGGGTTGGGGGTGGG - Intronic
1155295922 18:24384577-24384599 CAAACAAAAGGGCCGGGGGCGGG + Intronic
1155475404 18:26232358-26232380 CAGTCAAAGGGCCAGTGGGTTGG + Intronic
1155491052 18:26402249-26402271 CATTCAAAAGGTCTGGGGTGGGG - Intergenic
1156733427 18:40223699-40223721 TAGACAAAAGGGATGGGGTTGGG + Intergenic
1157445447 18:47743279-47743301 CACTAACAAGTGCTGGGGGTTGG - Intergenic
1159282507 18:66305017-66305039 CTGTTAACAGGGCTGGAGGTAGG - Intergenic
1160335071 18:78031527-78031549 CAGAGAAATGGGCTGGGGGAGGG - Intergenic
1160768725 19:821198-821220 TGGTCAGAGGGGCTGGGGGTCGG - Intronic
1160769158 19:822464-822486 GAGACAAAAGAGCTGGGGGAGGG + Intergenic
1161017804 19:1991804-1991826 CAGCCCAAAGGGCGGGGGCTGGG - Intronic
1161153099 19:2719871-2719893 CAGTCACAAGGGCTTGGGGCCGG + Intronic
1161260837 19:3337009-3337031 CTGCCAACAGGGCTGGGGGTGGG + Intergenic
1161465563 19:4428456-4428478 CAGTCTCAAGGGCCGGCGGTGGG - Intronic
1161773837 19:6246609-6246631 CGGTTGTAAGGGCTGGGGGTGGG + Intronic
1161800016 19:6412337-6412359 GAGACAGAGGGGCTGGGGGTGGG + Intergenic
1162707194 19:12563921-12563943 CAGTTAAGAGGGGTTGGGGTCGG + Intronic
1164693280 19:30226229-30226251 GAGTAAAAAGGGGAGGGGGTAGG + Intergenic
1165305085 19:34998839-34998861 CAGTGCAAAGGTCTTGGGGTAGG + Intronic
1165394406 19:35556509-35556531 CAGTCACTGGGGCTGGGGGATGG - Intronic
1165422164 19:35727662-35727684 AAGTTAGCAGGGCTGGGGGTGGG - Intronic
1165485648 19:36093973-36093995 CAGGCAAATGGGCTGGTGGTGGG - Intronic
1165931657 19:39363034-39363056 CAGTCAGAGGGGCTAGGGTTTGG - Intronic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1166975701 19:46603955-46603977 CACTGTAAGGGGCTGGGGGTGGG - Intronic
1167502693 19:49856677-49856699 CAGTCAGGAGGGCTGGCGGCAGG + Intronic
1167575240 19:50314786-50314808 AGGTCAAAGGAGCTGGGGGTGGG - Intronic
1167697999 19:51026218-51026240 CCTTCAAAAGGGCAGGGGTTTGG - Intronic
1168400567 19:56083919-56083941 CACTCAAAGAGGCTGTGGGTGGG - Intergenic
925069534 2:956003-956025 CAGTCACAAGGGCAGTGGGTGGG - Intronic
925181537 2:1820134-1820156 GAGTAAGAAGGGCTGGGGCTTGG + Intronic
927379965 2:22468008-22468030 CTGTCAAAAAGGCTGGGTGGGGG + Intergenic
929444227 2:41990141-41990163 CAGGAAAATGGGGTGGGGGTGGG + Intergenic
930062070 2:47298374-47298396 CAGTCCCAAGGGCTGCTGGTTGG - Intergenic
930781599 2:55229413-55229435 CAGTCCAAAGGCCTCAGGGTGGG + Intronic
932412553 2:71555881-71555903 CAGTGACAAGGCCTGGGGGTTGG + Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932785419 2:74597477-74597499 CAGAAAAAAGGGCTGGGGGTGGG - Intronic
933141291 2:78794867-78794889 CAGTCACAAGGAAGGGGGGTGGG - Intergenic
934231754 2:90190105-90190127 CAAGCAAAACGGCAGGGGGTGGG - Intergenic
934481883 2:94656900-94656922 ATGTCAAAATGGCTGGGCGTGGG - Intergenic
935699750 2:105801314-105801336 CAGACGTAAGGGCTGGGGCTGGG - Intronic
937216648 2:120317427-120317449 GAACCAACAGGGCTGGGGGTTGG + Intergenic
937291623 2:120785441-120785463 CAGACAGAAGGGCTGGGTGCAGG + Intronic
937391396 2:121490459-121490481 TTGTAAAAAGGGTTGGGGGTTGG + Intronic
938650500 2:133377911-133377933 CAGTCTAATTGGCTGGGGGCAGG + Intronic
939119443 2:138099229-138099251 AAGTGAGAAGAGCTGGGGGTGGG - Intergenic
939920665 2:148108123-148108145 TAGGGAAAAGGGTTGGGGGTGGG + Intronic
941343049 2:164330789-164330811 CCTGCAACAGGGCTGGGGGTGGG + Intergenic
941628121 2:167852651-167852673 CAGTGAAAAGGGCTAGGCATGGG + Intergenic
942060585 2:172225317-172225339 CTGTCATAAGGACTGGGGGATGG - Intergenic
942133318 2:172901986-172902008 GAGTCATGAGGACTGGGGGTTGG + Intronic
942513050 2:176723084-176723106 CAGTCAAGAGGTCTGGGTATTGG + Intergenic
944757659 2:202780676-202780698 CAGACCAGAGGGCTGGGGTTTGG + Intronic
945835061 2:214829938-214829960 AGGGGAAAAGGGCTGGGGGTAGG - Intergenic
945908985 2:215625044-215625066 CATTAAAAAGGGCTGGGGGAGGG + Intergenic
946196167 2:218034030-218034052 CTGTCGCAAGGGCTGGGGGCGGG - Intergenic
946411734 2:219518587-219518609 CTGTCTACAAGGCTGGGGGTGGG - Intronic
946456483 2:219830705-219830727 GGGTCAGAAGGTCTGGGGGTGGG + Intergenic
948777319 2:240296558-240296580 CAGAGATAAGTGCTGGGGGTGGG + Intergenic
1169299317 20:4428326-4428348 CAGGAAACAGGGCTGGGAGTTGG + Intergenic
1169867673 20:10218421-10218443 CACTGAAAGGGGGTGGGGGTGGG + Intergenic
1170303390 20:14911167-14911189 CATTCAATAGGTCTGGGGGAGGG - Intronic
1170472303 20:16680408-16680430 CATTCTAAAGTACTGGGGGTTGG - Intergenic
1172021428 20:31917019-31917041 CAGCCAACAGGGTTGGGGATAGG + Intronic
1173182226 20:40814107-40814129 CAGGCTGAAGGGCTGGGGGAAGG - Intergenic
1174313589 20:49678992-49679014 CATTAAAAGGGGCTGGGGGTGGG + Intronic
1174378248 20:50140313-50140335 CAGGGAAGATGGCTGGGGGTGGG - Intronic
1175645451 20:60667069-60667091 CAGTCGCAGGGGCTGGGGGAGGG - Intergenic
1176178139 20:63738172-63738194 CAGGCCGCAGGGCTGGGGGTGGG - Exonic
1177197994 21:17923108-17923130 CAGTGAGCAGGGGTGGGGGTTGG + Intronic
1178482819 21:32994428-32994450 CAGATAAATGGGATGGGGGTGGG + Intergenic
1178629015 21:34243249-34243271 CAGTGAAATGAGCTGGGGGTGGG + Intergenic
1179003498 21:37485566-37485588 CATTCAAAAAGCCTGGGGATGGG - Intronic
1179032840 21:37735490-37735512 CAGTGAGAAGGGCTGGAGGAGGG - Intronic
1179623183 21:42632287-42632309 GAATCAGAAGCGCTGGGGGTGGG + Intergenic
1179636683 21:42715928-42715950 CAGTAAAAAGATCTGGGGCTTGG - Intronic
1179675984 21:42982276-42982298 CACTCAAAGGGGCTGTGGATTGG + Intronic
1179969977 21:44830599-44830621 CACCCAAAAGGGGTGGGGGTGGG + Intergenic
1180110090 21:45643485-45643507 CAGTCAAAGGGGCGGGGGTGGGG - Intergenic
1180476494 22:15714336-15714358 CAATCAGAAGGGCTGGGGCAGGG - Intronic
1181944250 22:26503406-26503428 CAGAAAATAAGGCTGGGGGTTGG - Intronic
1182670799 22:31994227-31994249 CAATCAGAAGGTCTGGGGATGGG - Intergenic
1182677520 22:32051198-32051220 CATTCCAAAGGGCAGGGAGTGGG + Intronic
1182764369 22:32748035-32748057 CAGTGAAAAGAGCTTGGTGTTGG + Intronic
1183302008 22:37063166-37063188 CAATGCAAATGGCTGGGGGTGGG - Exonic
1183302639 22:37065834-37065856 GAGGCAGAAGGGCTGGGTGTGGG + Exonic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
1185205853 22:49537873-49537895 CAGTCAGAAGGTCTGGGGAGAGG + Intronic
950041538 3:9922835-9922857 CAGCAAAAAGGGCCTGGGGTGGG + Intronic
950214185 3:11146568-11146590 CATCCACAAGGGATGGGGGTAGG + Intronic
951021083 3:17781496-17781518 CAGTCAAAGGGCCAGTGGGTTGG - Intronic
951114522 3:18844361-18844383 TAGCCAAAAGGGTGGGGGGTGGG - Intergenic
951503599 3:23417508-23417530 CAGTCAGGAGGCATGGGGGTTGG + Intronic
952430678 3:33219729-33219751 CACTGAACAGGGCTGGTGGTAGG - Intergenic
952447224 3:33393078-33393100 CATCCTAAAGGGCTGGGGGGAGG + Intronic
952961022 3:38589156-38589178 CAGGCAATGGGGCTGGGGGTTGG - Intronic
953677527 3:45014876-45014898 CAGTCAAAGGGGATGGGGGATGG + Intronic
955317383 3:57950007-57950029 CAGCCACGTGGGCTGGGGGTGGG + Intergenic
956239128 3:67109303-67109325 CAATTCCAAGGGCTGGGGGTAGG + Intergenic
956913713 3:73848707-73848729 AAATCAAAAGCTCTGGGGGTGGG + Intergenic
957917974 3:86710193-86710215 TATTCAAAAGGGCTGGGTATGGG - Intergenic
959222688 3:103541661-103541683 CAGTGCAAAGGACTTGGGGTGGG + Intergenic
960263876 3:115598240-115598262 AAGAAAAAAGAGCTGGGGGTGGG + Intergenic
961262222 3:125611286-125611308 CATTCTAAAGTACTGGGGGTGGG + Intergenic
961630628 3:128295948-128295970 CAGTCACAAGAGCTGAGGCTGGG - Intronic
961938349 3:130610410-130610432 CAGTCAAACTGACTGGGGCTTGG - Intronic
962288934 3:134114023-134114045 CAGTGAATGGGGGTGGGGGTGGG - Intronic
962583742 3:136820205-136820227 GGGTCCAGAGGGCTGGGGGTAGG + Intronic
963140804 3:141944620-141944642 CAGTCAGAAGTGCTGGAGGTGGG - Intergenic
963840993 3:150106224-150106246 CAGTCAAATAGATTGGGGGTGGG - Intergenic
964066268 3:152583646-152583668 CAGTCACAAGGGGCAGGGGTGGG + Intergenic
964735596 3:159913886-159913908 CAGACAACATGGCTGGGAGTAGG + Intergenic
965772463 3:172195191-172195213 AAGTTAAGAGGGGTGGGGGTTGG - Intronic
965781001 3:172285840-172285862 CAGTTAAAAGGCCTTGGGGAAGG + Intronic
965867787 3:173226499-173226521 GAGGCAAAAATGCTGGGGGTGGG - Intergenic
967570297 3:191020113-191020135 CAAGCAATAGAGCTGGGGGTGGG + Intergenic
967726571 3:192867916-192867938 CACACAAAAAGGCTGGGGATGGG + Intronic
969308449 4:6338744-6338766 CACTCAAAGGCTCTGGGGGTGGG + Intronic
969722208 4:8898339-8898361 AAGCCAGAAGGGCTGGGGGAAGG + Intergenic
970163195 4:13209779-13209801 AAGTGAAAAGGGGTGGGGCTGGG - Intergenic
970977065 4:22054282-22054304 CAGTTAAAAGGCTTTGGGGTGGG - Intergenic
971150413 4:24025514-24025536 GAGTCAAAGGGGGTGGGGCTGGG - Intergenic
971579001 4:28309686-28309708 CAGTCAAAGGGCCAGTGGGTCGG - Intergenic
971582361 4:28358211-28358233 CTGTCAAGAGTGCTGGTGGTGGG - Intergenic
971850416 4:31978671-31978693 TAGTCAAAGGTGCTGGGGATTGG - Intergenic
973967015 4:56173054-56173076 CAGTCAGAAAGGCTGGGTGTTGG - Intronic
975495274 4:75029730-75029752 CAGTGAGAAGGGCAGGGGGCTGG + Intronic
976813391 4:89120692-89120714 AATTCCAAAGGGCGGGGGGTGGG - Intergenic
977291290 4:95167603-95167625 CAGTCAGGAAGGCTGGGGGCAGG + Exonic
977628246 4:99212634-99212656 CATTTTAAAAGGCTGGGGGTGGG - Intronic
978558206 4:110003696-110003718 CATTCACTAGGGGTGGGGGTGGG - Intronic
980029434 4:127809760-127809782 CAGTCAAACTTGCTAGGGGTTGG - Intronic
980635240 4:135493706-135493728 CAGTCAGAAGGGCTTGTGTTTGG - Intergenic
982211251 4:153038620-153038642 CAGAGAATAGGGTTGGGGGTTGG - Intergenic
983577985 4:169279105-169279127 TAGTCAAAAGGTCAGGGGGAGGG + Intergenic
983793532 4:171829130-171829152 CATTGAAAAGTGCTGGGGCTAGG - Intronic
985063598 4:186101518-186101540 CATTCACAAGAACTGGGGGTGGG + Intergenic
986019539 5:3788474-3788496 CAGTGAAAAGAGATAGGGGTGGG + Intergenic
986203235 5:5598876-5598898 CACGCAAAACAGCTGGGGGTGGG + Intergenic
986254628 5:6091879-6091901 GAATCAGAAGCGCTGGGGGTGGG + Intergenic
987287857 5:16476747-16476769 CTGTCAATAGGGTTGGGGGTGGG + Intronic
987331761 5:16863315-16863337 CAGTCCAAAGGGGCTGGGGTGGG + Intronic
988923869 5:35969540-35969562 TAGTCAAAAGGGGTGGGGAGGGG + Intronic
990117152 5:52403134-52403156 CAGTGAAAGGGCCAGGGGGTTGG - Intergenic
990842166 5:60094476-60094498 CATTCTAAAGTACTGGGGGTGGG - Intronic
991897777 5:71423251-71423273 CAGCCCACGGGGCTGGGGGTAGG - Intergenic
992009368 5:72511526-72511548 CTGTAAAAAGGGCAGGGGGATGG - Intergenic
992142035 5:73808236-73808258 AAATAAAAAGTGCTGGGGGTTGG + Intronic
992418055 5:76572018-76572040 CAGGGAACAGGGCTGGGGGAGGG - Intronic
992646873 5:78819385-78819407 CAGACAAAAAGACTGTGGGTGGG + Intronic
993335050 5:86646603-86646625 AAGTGAAAAGGGCTGTGGGAAGG + Intergenic
994314490 5:98316556-98316578 CATACAAAAGGGCTGGTGGGGGG + Intergenic
996035895 5:118758634-118758656 CATTCAGAAGGGCTGGGAATGGG - Intergenic
996055689 5:118979842-118979864 CTGTCAGGAGGGCAGGGGGTGGG + Intronic
996296697 5:121926791-121926813 CAGATAAAAGGACTGTGGGTTGG - Intergenic
997412960 5:133704070-133704092 CAGGGAACAGGGCTGGGGATAGG + Intergenic
997733003 5:136194149-136194171 CAGACAACAGGGCTGGGACTAGG - Intergenic
998041834 5:138955405-138955427 CAGGGAGATGGGCTGGGGGTGGG + Intronic
998128763 5:139640689-139640711 CAGTGGACAGGGCTGGGGGATGG + Intergenic
998332636 5:141342968-141342990 CAGTGAAAAGGCCTGGATGTGGG - Intronic
998463456 5:142325518-142325540 CAGTCAAAAGGGGGGGCGGGAGG + Intronic
998831035 5:146159123-146159145 GAATCAAAAGTTCTGGGGGTGGG - Intronic
999745068 5:154585603-154585625 CAGTCAGAAGGCCTGTGTGTGGG + Intergenic
1000368280 5:160511033-160511055 GAGTGAAAAGGGCAGCGGGTGGG - Intergenic
1001081125 5:168668309-168668331 GACTCAAAAGGGCTGGGGTGGGG + Intronic
1001116920 5:168947715-168947737 CAGACCCAAGGGCTGGGGCTGGG + Intronic
1003146550 6:3514895-3514917 CAGACCAGAGGGCTGGGTGTCGG + Intergenic
1003874493 6:10423901-10423923 CAGCAAAAAGTGTTGGGGGTGGG + Intergenic
1004928700 6:20440914-20440936 CAGTGAAAAGGGTCAGGGGTAGG + Intronic
1006171354 6:32095242-32095264 GAGTAAAAGGGGCTGTGGGTGGG - Intronic
1006470778 6:34227455-34227477 GAGTGAAAAGGGCTGGGGGAGGG - Intergenic
1006789041 6:36686681-36686703 CAGTCCATTGAGCTGGGGGTGGG - Exonic
1007209383 6:40179943-40179965 GAGTCCAAAGGGCTGGGGGTGGG + Intergenic
1007556531 6:42771017-42771039 CAGTGAAAAGCTCTGGGAGTCGG - Intronic
1007746232 6:44044384-44044406 CAGTCAGAATGGCTGGGGAGCGG + Intergenic
1007812922 6:44498996-44499018 CAACCAAAAGGGCTGGGGAGAGG - Intergenic
1007997320 6:46322010-46322032 CAGGTAAAAGTTCTGGGGGTGGG + Intronic
1008267305 6:49444285-49444307 CAGTTAAAATGGCTGTGGGGTGG - Intronic
1009975744 6:70668423-70668445 CCCTCCACAGGGCTGGGGGTAGG + Intronic
1009991732 6:70851675-70851697 CATTTATAAGGGCTGGGGGCAGG - Intronic
1010294522 6:74181149-74181171 CAGTCAGAAGGTCTGGAGATAGG + Intergenic
1010767138 6:79788789-79788811 CAGATAAAAGGGTTGGGGGCTGG - Intergenic
1012342337 6:98142841-98142863 CAGTCAAAGGGGCCGGGGTCAGG - Intergenic
1013806411 6:114000715-114000737 CAGAGAACAGGGCTGGGGATGGG - Intronic
1013888033 6:114994790-114994812 CAGCCATAAGGGCTGCTGGTTGG - Intergenic
1014032017 6:116717092-116717114 CGGTTAAAAGGGCAGTGGGTGGG - Intronic
1014098352 6:117483176-117483198 AAGTGAAATGGGCTGGGGGGCGG - Intronic
1016415125 6:143824062-143824084 CACTGAAAAGGGGTGGGAGTTGG + Exonic
1017790122 6:157790549-157790571 CAGAAAACAGGGCTGGGGGTGGG - Intronic
1017910519 6:158788337-158788359 CACCCAAAAGGGATGGGGGAAGG + Intronic
1018743407 6:166747047-166747069 AATTCAAAAGGACTGGGGCTGGG - Intronic
1019126091 6:169840948-169840970 CAGCAAAGAGGGGTGGGGGTGGG - Intergenic
1019359297 7:596490-596512 CTCTCAGCAGGGCTGGGGGTGGG - Intronic
1020078631 7:5274821-5274843 TTGTCAAAAGGGCTGGGTGAAGG - Intronic
1023485087 7:40677721-40677743 CAGTCAAAAGAGAATGGGGTTGG + Intronic
1024235084 7:47391801-47391823 CACACAAGAGGGCTGTGGGTGGG - Intronic
1024588831 7:50863731-50863753 CATTCATCAGGGCTTGGGGTGGG - Intergenic
1024744762 7:52393162-52393184 GAGTAACAAGGGCTGGGGGAGGG + Intergenic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1026002377 7:66570868-66570890 CATTCAAAAAGACGGGGGGTGGG + Intergenic
1026436681 7:70405233-70405255 CATTCAAAAGGGCAGGGAGGAGG - Intronic
1026448711 7:70508260-70508282 CTGTCAAAAAGGAGGGGGGTAGG + Intronic
1027182157 7:75948374-75948396 CAGCCAACAGGGGTGGGGCTTGG - Intronic
1027562047 7:79742586-79742608 CAGTAGAATGGGCTGGGGTTTGG - Intergenic
1028703644 7:93813081-93813103 CAAGCAAAATGGCTGGGGGATGG - Intronic
1029540469 7:101179621-101179643 CAGCCAAAGGGGGTGGGGGGAGG + Intronic
1031938992 7:127767219-127767241 CAGTGGAAAGGGATGGGGGAAGG - Intronic
1032542503 7:132715036-132715058 CAGGAGAAAGGGCTGGGGGTGGG - Intronic
1033327280 7:140390261-140390283 TGGTCAAAAGGGCTGGGGGTGGG - Intronic
1034678172 7:152907558-152907580 CAGTCAGAAGGGGTGAGGGAGGG - Intergenic
1034822942 7:154233911-154233933 CAGTGAGAAAGGCTGTGGGTTGG + Intronic
1035716037 8:1755613-1755635 CTGCCCAGAGGGCTGGGGGTTGG + Intergenic
1036510155 8:9392535-9392557 CAGGCAGAAGCTCTGGGGGTGGG + Intergenic
1036789152 8:11706757-11706779 CAATCAGAAGGGGTGGGGGAAGG - Intronic
1038055491 8:23853843-23853865 CAGGCAGCAGGGTTGGGGGTGGG + Intronic
1038296473 8:26295909-26295931 CAGTCTAAAGGTAGGGGGGTGGG - Intronic
1039407844 8:37328186-37328208 CCTTCAACAGGGCTGAGGGTCGG + Intergenic
1039509222 8:38077454-38077476 CAGTCAGTGGGGGTGGGGGTGGG + Intergenic
1039836500 8:41260400-41260422 CAATCAGAATGTCTGGGGGTGGG + Intergenic
1039969199 8:42307183-42307205 AGGTGAAAAGGGCTGGAGGTGGG + Intronic
1040459654 8:47635026-47635048 CAGTTAAAAGAACTGTGGGTTGG + Intronic
1042772506 8:72394765-72394787 CAGTCAAAGGGCCAGTGGGTTGG - Intergenic
1044004651 8:86926331-86926353 CAGTCAAAGGGCCAGTGGGTCGG + Intronic
1046157374 8:110310299-110310321 CAGTGAAAAGTGTTGGGGGGTGG - Intergenic
1047163128 8:122404340-122404362 TAGTCAAAAGGGCTTGGCTTGGG - Intergenic
1047912639 8:129546996-129547018 CATTCATGAGTGCTGGGGGTGGG - Intergenic
1048006555 8:130424312-130424334 CAGACCAATAGGCTGGGGGTGGG - Intronic
1048922832 8:139246478-139246500 CAGCCTAAAGGACTGGAGGTAGG - Intergenic
1049491226 8:142904155-142904177 CAGTCTGGAGGCCTGGGGGTTGG - Intronic
1050531204 9:6591202-6591224 CAGTCACAAAGGCTGGGAGAGGG - Intronic
1051409531 9:16775140-16775162 GAATCAAAAGACCTGGGGGTAGG + Intronic
1052330132 9:27259431-27259453 CAGACAGAAGGGCTCAGGGTAGG - Intergenic
1053129824 9:35608603-35608625 TAGTTGAAAAGGCTGGGGGTCGG + Intronic
1054731615 9:68706468-68706490 CAGACAAGAGAGCTGGGGGTTGG - Intronic
1054813136 9:69450667-69450689 AAGTCAAAGGCACTGGGGGTTGG - Intronic
1054976972 9:71158921-71158943 GAATCAAGAGGGCTGAGGGTAGG - Intronic
1054984904 9:71250715-71250737 CAGTAAGAAGGGCAGGGGGCAGG + Intronic
1055469299 9:76595377-76595399 GATTCAACAGGTCTGGGGGTGGG + Intergenic
1055951737 9:81735755-81735777 CAGAAGCAAGGGCTGGGGGTGGG + Intergenic
1057877217 9:98767348-98767370 CAGGTAAAAGGGGTGTGGGTGGG - Intronic
1058519819 9:105806476-105806498 CTGCCAAAATCGCTGGGGGTGGG - Intergenic
1059100790 9:111469886-111469908 CTGTAAAAAAGGCTGGGGATGGG - Intronic
1059759360 9:117323596-117323618 CATTCAAAGAGGCTGGAGGTGGG + Intronic
1059806566 9:117807422-117807444 CAGTTAAAAGGTTTGGGGGTTGG - Intergenic
1060281523 9:122218844-122218866 CAGTGCAAAGGCCTGGGGGTGGG - Intronic
1060744780 9:126124120-126124142 CAGTGAGGAGGGCTGGGGCTTGG + Intergenic
1060798472 9:126528252-126528274 CATTCCATAGGGTTGGGGGTTGG - Intergenic
1061265849 9:129504667-129504689 CAGTTCAAAGGGCCTGGGGTGGG - Intergenic
1061339030 9:129963908-129963930 CTGTGAAAAAGGCTGGGGCTGGG - Intronic
1061464323 9:130765937-130765959 CAGTCACAAGGACAGGGTGTTGG + Intronic
1061482423 9:130903556-130903578 CAGGGAAACGGGGTGGGGGTTGG + Exonic
1062133197 9:134911317-134911339 CAGGCATGAGGGCTGGGGATGGG + Intronic
1062681259 9:137782720-137782742 CAGTCAACGGGGCTGGGGGAGGG - Intronic
1186765629 X:12767958-12767980 GAGCCACAGGGGCTGGGGGTGGG + Intergenic
1187736788 X:22312839-22312861 CAATCACAATGTCTGGGGGTGGG + Intergenic
1188098106 X:26047059-26047081 CAGCCAAAAGGTCAGTGGGTTGG - Intergenic
1188104471 X:26133028-26133050 CACTCACCAGGGCTGGGGCTAGG + Intergenic
1188105786 X:26145374-26145396 CAATCCCAAGGGCTGGAGGTGGG - Intergenic
1188450869 X:30307447-30307469 CAGTAAAATGGGGTGGGGGGAGG + Intronic
1188473014 X:30561352-30561374 CAGTGACAATTGCTGGGGGTAGG - Intronic
1188555201 X:31404023-31404045 AAGTGAAGAAGGCTGGGGGTAGG - Intronic
1190055367 X:47178404-47178426 GAGGGAAATGGGCTGGGGGTGGG - Intronic
1191726047 X:64282355-64282377 CTGTCAGAAGGGGTGGGGGTAGG + Intronic
1191865171 X:65698092-65698114 CAGTCACAGGGTATGGGGGTGGG + Intronic
1192332681 X:70190459-70190481 CAGTCAACAAGCCTGGGTGTGGG - Intronic
1193636249 X:83952765-83952787 CAGGGAAAAGGGTTGGGGGGTGG + Intergenic
1194783070 X:98048812-98048834 CAGTCAGGAGGCATGGGGGTTGG + Intergenic
1195206537 X:102605121-102605143 CAGTAAAAGAGGCAGGGGGTAGG - Intergenic
1195315130 X:103670016-103670038 AGGTCAAAAGAGCAGGGGGTGGG - Intergenic
1195632781 X:107076543-107076565 TAGTCACCAGGGCTGGGGGAAGG + Intronic
1196287594 X:113900258-113900280 CAGTGAATGGGGATGGGGGTGGG - Intergenic
1196714026 X:118794017-118794039 CAGTAAAAATGGCTAGGGGGAGG - Exonic
1197620591 X:128743369-128743391 CAGACACAAGGGCTGGTGGTTGG - Intergenic
1197990667 X:132313365-132313387 CAGTAAAATGGGGTGGGGGGAGG - Intergenic
1198654286 X:138896941-138896963 CAGTCTAAAGTTCCGGGGGTGGG + Intronic
1199284054 X:146036831-146036853 GAGTCAAAAGGGCAGGGGGTGGG - Intergenic
1199780174 X:151051334-151051356 CAGTTAACAGGGATGGGTGTGGG + Intergenic
1200150355 X:153948324-153948346 CAGGCAAAAGGGCAGAGGGCAGG + Exonic
1201311318 Y:12600437-12600459 CAGTCAAAGGGCCAGTGGGTTGG + Intergenic
1201989273 Y:20007056-20007078 CAGTCAAAGGGCCAGTGGGTTGG + Intergenic