ID: 907872719

View in Genome Browser
Species Human (GRCh38)
Location 1:58457440-58457462
Sequence GGCACAGGCCGCTTAATAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 38}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907872719_907872728 30 Left 907872719 1:58457440-58457462 CCCCTTATTAAGCGGCCTGTGCC 0: 1
1: 0
2: 0
3: 3
4: 38
Right 907872728 1:58457493-58457515 CAGCTCATGTTGTACAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907872719 Original CRISPR GGCACAGGCCGCTTAATAAG GGG (reversed) Intronic
904594041 1:31631934-31631956 GGCTCAGGCAGGTTAGTAAGAGG - Intronic
907872719 1:58457440-58457462 GGCACAGGCCGCTTAATAAGGGG - Intronic
920212147 1:204335957-204335979 GGCACATGCCCCTACATAAGGGG + Intronic
920337970 1:205257658-205257680 GGCCCAGGCACCTTATTAAGTGG + Intronic
923202637 1:231726704-231726726 GGCAAAGGCAGTTTTATAAGTGG + Intronic
1066417293 10:35233066-35233088 GGCACTGGTGGCTTTATAAGAGG + Intergenic
1070892140 10:79948872-79948894 GGCTGAGGCCACTGAATAAGGGG + Intronic
1077240429 11:1507839-1507861 GGCCCAGGCCGCCTAAGAACAGG + Intergenic
1079485204 11:20928900-20928922 AACAAAGGCCTCTTAATAAGAGG - Intronic
1080183248 11:29448453-29448475 GCCACAGGCCCCTTAATTACAGG - Intergenic
1081706637 11:45185895-45185917 ATCACAGGCATCTTAATAAGAGG + Intronic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1084801539 11:71547424-71547446 GGCACAGGCCGCATGATTTGTGG - Intronic
1087258295 11:95981276-95981298 GCCACAGGCTGTGTAATAAGAGG + Intronic
1090950436 11:131468215-131468237 GGCTCAGGCCACCTAATGAGAGG + Intronic
1105342336 13:19539051-19539073 GGCACTGGTGGCTTTATAAGAGG - Intergenic
1110091040 13:71448656-71448678 TGCACAGGCCCATTTATAAGAGG + Intronic
1110217125 13:73035414-73035436 GGCACAGTGAGCTTAATAAGTGG - Intergenic
1117257710 14:53996556-53996578 GGCCCAGGGCACTTAATATGTGG + Intergenic
1117571274 14:57051499-57051521 AGCACAGGCCACTTAAAAAGCGG - Intergenic
1119558085 14:75568584-75568606 GGCAAAGGCCGCATAAGAACAGG - Intergenic
1141830833 16:86509429-86509451 CGCACAGGCCCCTGAATAAGCGG - Intergenic
1148227715 17:45910510-45910532 GGCACTGGCAGTTTAATAAAGGG - Intronic
1148734085 17:49854862-49854884 GGCACAGGCATTTTAATTAGGGG - Intergenic
1148761211 17:50001720-50001742 GGCACAGGAAGCTAAGTAAGTGG + Intergenic
1148790789 17:50171546-50171568 GGCACAAGCGGCTTATCAAGGGG - Intronic
1152441544 17:80312899-80312921 GGCACAGGCTGCTCAAGGAGTGG - Intronic
1161748142 19:6074372-6074394 GGCACAGGCCGGGTGCTAAGAGG - Intronic
930651489 2:53969382-53969404 GTCAGAGGCCCCTTAATAATTGG + Intronic
931968930 2:67564729-67564751 GCCACAGGCCGTTTAGTAAATGG - Intergenic
932141709 2:69284383-69284405 GTCACAGGTTGCTTAATAAAGGG - Intergenic
939445010 2:142298424-142298446 GACGCAGCCCGCTTACTAAGAGG + Intergenic
941746587 2:169093181-169093203 TGCTCAGGCCTCTTAATCAGTGG + Intronic
966596361 3:181727372-181727394 GGCACAGTCCGCACAAAAAGGGG + Intergenic
977019084 4:91736701-91736723 GGGACTGGCAGCTTTATAAGAGG + Intergenic
992249711 5:74865549-74865571 GGCACAGGCCTCTTGAAAAATGG + Intronic
993700652 5:91114817-91114839 TGCACAGGCAGCTTCAGAAGTGG + Intronic
1013013209 6:106138226-106138248 GGGACAGGCTGCTGAACAAGAGG - Intergenic
1023718873 7:43072592-43072614 GCCACTGGCTGCTTAAAAAGTGG - Intergenic
1028674788 7:93446466-93446488 GGCACAGGATTCTTAATCAGGGG - Intronic
1188909925 X:35834282-35834304 GTCTCAGTCCGTTTAATAAGGGG + Intergenic
1202589988 Y:26472590-26472612 GGCACTGGTGGCTTTATAAGAGG + Intergenic