ID: 907876659

View in Genome Browser
Species Human (GRCh38)
Location 1:58495525-58495547
Sequence TGTGGTTTTCTAACAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907876659 Original CRISPR TGTGGTTTTCTAACAATGGC AGG Intronic
903463567 1:23536226-23536248 TGGGCTTTTCTAACAGTGACTGG + Intergenic
903820388 1:26097883-26097905 TGTGGCTTTCTAACAAGGGGAGG - Intergenic
904083106 1:27884478-27884500 AGTCATTTTCTGACAATGGCTGG + Intronic
905795102 1:40811548-40811570 TGTGGTTTTCAAACTACGGTGGG - Intronic
907441977 1:54484574-54484596 TGTGGTATTCAAGCAGTGGCTGG + Intergenic
907876659 1:58495525-58495547 TGTGGTTTTCTAACAATGGCAGG + Intronic
911091549 1:94021386-94021408 TGTGGTTTAATAACAAAGGCTGG - Exonic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
916065148 1:161130774-161130796 TATTGTTTTCAAACAATGGAAGG - Intronic
916534071 1:165686571-165686593 TGAGGTTTTCTCACCATGGCTGG - Intronic
917016738 1:170540630-170540652 TGTAGTTTACTAACAAAGGCCGG + Intronic
919458251 1:197845876-197845898 TGGGTGTTTATAACAATGGCTGG - Intergenic
924828143 1:247563420-247563442 TGTGGTTTTTCAAAAAAGGCTGG + Intronic
1063505272 10:6592271-6592293 TGTGGTTTTCAAACACAGGAAGG + Intergenic
1065859743 10:29862298-29862320 TGTCCTATTGTAACAATGGCTGG + Intergenic
1066447042 10:35492820-35492842 TGTCGTTTTCTAACAAAGCTAGG - Intronic
1071418281 10:85461955-85461977 TGTTGTTCTCTATCATTGGCTGG + Intergenic
1072173235 10:92888194-92888216 TTTGGTTTTCTATTAATGGAGGG + Intronic
1073702158 10:105939813-105939835 AGTGGTTTTCTATGAATGGAGGG + Intergenic
1076153460 10:128184087-128184109 TGTGGTTTGTTGAAAATGGCTGG - Intergenic
1076544430 10:131235366-131235388 TGTGGTTTTCTAGCAAGGCTCGG - Intronic
1077036850 11:499478-499500 TGTGGTCAACTCACAATGGCCGG + Intronic
1077372007 11:2186730-2186752 TGTTGTTGTCTAAAAATGCCTGG - Intergenic
1081246732 11:40775963-40775985 TGTGGATTTTTAACAATGAAGGG + Intronic
1081320150 11:41682145-41682167 TATGGTTTTGTTACAATAGCTGG + Intergenic
1083061082 11:59873133-59873155 AGTGGTTTCCTAAGACTGGCAGG - Intergenic
1084692376 11:70734752-70734774 TGTGGCTATGTAACACTGGCTGG - Intronic
1085405504 11:76259442-76259464 TGGACTTTTCTAACAATGACAGG + Intergenic
1088011712 11:105010203-105010225 TGTGTCTTTCTAATAATGGTTGG - Intronic
1092323219 12:7500993-7501015 TGTGGTTTTCTAGCAATGGATGG + Intronic
1095323042 12:40852961-40852983 TGAGGTTTTTCAATAATGGCTGG + Intronic
1096311737 12:50527018-50527040 TTTGGTTTTATTACAATGTCTGG - Intronic
1098601632 12:72338249-72338271 TGTTGTTTTCTAACTAAGGACGG + Intronic
1101490127 12:105202289-105202311 TGTGGTTCTCTCAGGATGGCTGG + Intronic
1101751278 12:107584578-107584600 TTTGGTGTTCTAACAAATGCAGG + Intronic
1106920298 13:34556127-34556149 TGTGTGTTTCTAAGAATAGCCGG - Intergenic
1107257400 13:38445051-38445073 TGTGGATTACAAACAATGGAAGG - Intergenic
1108620308 13:52176275-52176297 TTTGGTTTTACAACAATGCCAGG + Intergenic
1108623305 13:52204689-52204711 TGGGGTTTTCAAACAATGCTAGG - Intergenic
1108666429 13:52636775-52636797 TTTGGTTTTACAACAATGCCAGG - Intergenic
1109850079 13:68051665-68051687 TGTGTTTTTCTAAAAATGTAAGG + Intergenic
1110151085 13:72254187-72254209 TTTTGTTTTCTAAAAATGGGTGG + Intergenic
1110846749 13:80198182-80198204 ATTGCCTTTCTAACAATGGCTGG - Intergenic
1121441700 14:93953778-93953800 AGTGGGTTTCCAGCAATGGCTGG - Intronic
1126948539 15:53852781-53852803 TTTAGTTTTCTAATTATGGCAGG + Intergenic
1127965366 15:63918977-63918999 TGTGGAGGGCTAACAATGGCGGG - Intronic
1130664705 15:85859980-85860002 TGTGATTTTCAAACATTGTCAGG + Intergenic
1133408166 16:5542966-5542988 TGAGGTTTTCCAACTCTGGCTGG - Intergenic
1134843830 16:17423364-17423386 TGTGGCCTTCCAACAATGGCTGG + Intronic
1135428130 16:22357354-22357376 TGTAGTCTTCTAAGAATGGAAGG + Intronic
1139258537 16:65568053-65568075 TGTGCCTGGCTAACAATGGCTGG - Intergenic
1140567233 16:76058465-76058487 AGTGGTTATCAACCAATGGCTGG - Intergenic
1140996281 16:80262756-80262778 TGTGCTTTTCTTACCATGGATGG + Intergenic
1141784086 16:86186927-86186949 TGTGGTTTGCTGACTACGGCAGG + Intergenic
1144148914 17:12424441-12424463 TGTGCTCTTCTAAGTATGGCTGG + Intergenic
1148462017 17:47844335-47844357 TGTGGTTGTGTAACCATGGTGGG + Intergenic
1149307873 17:55366610-55366632 TGTGTTTTTGTAGCAATGGAAGG - Intergenic
1152531856 17:80923468-80923490 TTTGTTTTTCTTCCAATGGCAGG + Exonic
1156473071 18:37389562-37389584 TGTGGTCTGCTCACCATGGCTGG + Intronic
1157580158 18:48769413-48769435 GCTGTTTTTCTAAAAATGGCTGG + Intronic
1158138960 18:54236643-54236665 TGTTCTTTTCTAACATTGTCTGG - Intergenic
1159851517 18:73531448-73531470 TGTGGTTTTTCAACACTGCCTGG + Intergenic
1166543867 19:43622897-43622919 TGTGGAACTCTTACAATGGCTGG + Exonic
1167026147 19:46920058-46920080 TGAGGATTTCTACCAGTGGCTGG + Exonic
925820323 2:7793587-7793609 TGTGGTATTTTGACAAAGGCAGG + Intergenic
926236575 2:11049997-11050019 TGTCGTTTTCCCACAAGGGCAGG + Intergenic
928983852 2:37161447-37161469 TGTGGTTTTTCAAGAATGCCAGG + Intergenic
929630331 2:43453616-43453638 TTTGGTTTTCTCACAAACGCTGG + Intronic
929946044 2:46372743-46372765 AGTGCATTTCTAACAATTGCAGG - Intronic
931428462 2:62191818-62191840 TGTCTTTTTTTAAAAATGGCTGG - Intergenic
936761314 2:115787147-115787169 TGTGATCTTCTAACAATTGTTGG - Intronic
938378228 2:130822534-130822556 TTTAGTTTTCCAACAATAGCAGG - Intergenic
938949224 2:136241800-136241822 TGTGGTGTTCTAACAGTGCTTGG + Intergenic
940340013 2:152570432-152570454 TGTATTTTTCTACAAATGGCAGG + Intronic
942495998 2:176540724-176540746 GGTGATATTCTAACAATTGCCGG - Intergenic
945184019 2:207121608-207121630 ACTGCTTTTCTAACAATGCCTGG + Intronic
947634113 2:231671542-231671564 TGTGGCTTTGCAACAGTGGCTGG + Intergenic
1170062901 20:12277552-12277574 TGTGGATTTTTATCAATGTCTGG - Intergenic
1170455768 20:16531461-16531483 CCTGGTTTTCTCACAGTGGCTGG - Intronic
1175069776 20:56323735-56323757 TGAGGTTTTGGAACAGTGGCAGG - Intergenic
1177678244 21:24331117-24331139 TAAGTTTTTCTAATAATGGCAGG + Intergenic
1182178630 22:28320465-28320487 TGTCATTTTCTAGCAGTGGCGGG - Intronic
949890622 3:8731295-8731317 TGTGGTTTTCCCACATAGGCTGG + Intronic
950271790 3:11622278-11622300 GGTGGGTATCTAGCAATGGCTGG - Intronic
951344373 3:21529207-21529229 TGGGGTTTTCTTACCATTGCAGG + Intronic
953029883 3:39172288-39172310 TGTGGGGTTCTAAAAATGGATGG + Intergenic
955737440 3:62054452-62054474 TGCTGTTTTCTAACACTGGTTGG + Intronic
957234346 3:77565570-77565592 TGTGTGTTTCTAACAGTTGCAGG - Intronic
958881706 3:99679481-99679503 TGCAGTTGTCTAACAATGACTGG - Intronic
960424412 3:117488533-117488555 TGTGGTTTGCTAACGATCTCTGG - Intergenic
964158599 3:153617807-153617829 TGTGAGTTTCTGACACTGGCAGG - Intergenic
964625087 3:158750849-158750871 TGGAGTTTACTAAAAATGGCTGG - Intronic
967336341 3:188348809-188348831 TGTGGTGTGCTGACAATGCCTGG + Intronic
971269493 4:25127799-25127821 TGTGGTTTTCTAATAGTTACTGG - Intronic
974144832 4:57934310-57934332 TGTGTTTAACTAACAGTGGCTGG - Intergenic
974320788 4:60346674-60346696 TTTGGTTTTCCAGCAATGGAAGG - Intergenic
975412054 4:74064814-74064836 TGAGCTTTTCTAACAATGTTGGG + Intergenic
975697530 4:77028203-77028225 TGTGCTTTTCTAAGAACAGCCGG + Intronic
975974415 4:80078870-80078892 TGTGGTTTCCTAACAATGGAAGG + Intronic
980752450 4:137109322-137109344 TATGGTTTTCTAGCAAGGCCCGG - Intergenic
982629709 4:157817202-157817224 TGTGGTTTTCTGAGTGTGGCTGG - Intergenic
983021698 4:162684634-162684656 TGGGGTTTTGTCACATTGGCTGG - Intergenic
984867906 4:184298549-184298571 TACGGTTTTCCAACATTGGCTGG - Intergenic
986155978 5:5176278-5176300 TAGGGTTTTCTAAGAAGGGCAGG - Intronic
991271168 5:64783246-64783268 GGTGGTTTTCTCACCATGACAGG - Intronic
993491411 5:88555823-88555845 TGTGGTTTTCTGTGAAAGGCAGG - Intergenic
994268872 5:97753137-97753159 TGAGGTTTCCTAACAAAGGAAGG + Intergenic
996278901 5:121703129-121703151 TGTGGTTTTATAACTATTGCTGG + Intergenic
996681655 5:126233992-126234014 TGTGGTTTTCTCCCAATGTGTGG - Intergenic
997997451 5:138597993-138598015 TGTGTTTTTCTAGCAATAGATGG + Intergenic
998943244 5:147308477-147308499 TGTGATTTACTAATAGTGGCAGG + Intronic
1001141810 5:169150834-169150856 GGTGGGTTTTTAAGAATGGCAGG - Intronic
1004307504 6:14514308-14514330 TGAAGTTTTCCAGCAATGGCAGG - Intergenic
1006245205 6:32727766-32727788 TGTGGTTTTTTAAAAATTGAAGG + Intergenic
1008411018 6:51179948-51179970 AATGGTTTTATAACAATGGAAGG + Intergenic
1016358238 6:143240846-143240868 TGTGAATTTATACCAATGGCCGG + Intronic
1017536766 6:155355436-155355458 AGTGGTTTTCTAACTATTGAGGG - Intergenic
1017989229 6:159471602-159471624 TTTTCTTTTCTACCAATGGCCGG + Intergenic
1021336419 7:19408184-19408206 TGTGGTATTCTAGGAATCGCTGG - Intergenic
1023029639 7:36081002-36081024 TGAAGTGTTCTAACAATGGGAGG - Intronic
1027504868 7:79003637-79003659 TTTAAGTTTCTAACAATGGCAGG + Intronic
1028270998 7:88789081-88789103 TGTTAATTTCTAACAATGGTTGG - Intronic
1030917804 7:115338704-115338726 TGCAGTTTTCTTACAATGGTTGG + Intergenic
1031363804 7:120879365-120879387 TGTGGTTTTCTAATTATGACAGG - Intergenic
1031627856 7:124010669-124010691 TGTTGTTTCTGAACAATGGCAGG + Intergenic
1031714638 7:125093345-125093367 TGTGTTTATCTAACAATGATGGG - Intergenic
1034948932 7:155284048-155284070 TGTGGTTTTCAAACAGTTGCTGG + Intergenic
1035610104 8:956312-956334 TGTGTTTTCCTAACAAGGCCTGG - Intergenic
1038972741 8:32655191-32655213 AGTGGTTTGGTAACAATGCCTGG + Intronic
1039160316 8:34611726-34611748 TGTGGTTTTCTAAAAAATACTGG - Intergenic
1044408332 8:91856266-91856288 TCTGGTGTTCTAACAAAGTCTGG + Intergenic
1045673707 8:104586639-104586661 TGTGGTTCTATAACAATAGTGGG - Intronic
1048637638 8:136315498-136315520 TGTGATTGTCTAAGAATGGTGGG - Intergenic
1049764701 8:144349374-144349396 TGGAGTTTTCTAACAGTTGCTGG - Intergenic
1050003543 9:1103510-1103532 TGTGTTTTCCTATCAATGACGGG - Intergenic
1050078633 9:1891351-1891373 TGTGGTTTCCTAAGTATGGCAGG + Intergenic
1050306934 9:4314241-4314263 TGTTGTTTTTTATTAATGGCAGG + Intronic
1051122083 9:13762255-13762277 TGTGGGTTTCTATCGCTGGCAGG + Intergenic
1053340786 9:37327584-37327606 ACTGGCTTTCTGACAATGGCGGG + Intronic
1054320541 9:63656903-63656925 CCTGTTTCTCTAACAATGGCCGG - Intergenic
1057338944 9:94181929-94181951 TGTGTTTTTCTTTAAATGGCAGG - Intergenic
1058417019 9:104799965-104799987 TGTGGTTCAATAACAAGGGCTGG - Exonic
1060774285 9:126359364-126359386 TGTGGTTTTCTTATAATATCTGG + Intronic
1061356411 9:130108925-130108947 TGGGTTTTTCTAATGATGGCAGG - Intronic
1187922155 X:24215357-24215379 AGTGGTTTTCAAAGTATGGCCGG + Exonic
1193166448 X:78286149-78286171 AGAGGTTTTCTAAGAATGTCAGG + Intronic
1193929054 X:87529678-87529700 TGTGTTTTTCAAAAAATGGCTGG + Intronic
1197086927 X:122489382-122489404 AGTGGTTTTCTAACAGAAGCTGG - Intergenic
1197356214 X:125439532-125439554 TGTGATTTTCTAGGAATGGAGGG - Intergenic
1197443183 X:126514805-126514827 TGAGGTTTTCTAGCAATGAATGG + Intergenic
1197805448 X:130394219-130394241 AGGGGGTTTGTAACAATGGCTGG + Intergenic
1199713323 X:150487811-150487833 TGAGGATTTTTAACAAAGGCTGG - Intronic
1201750981 Y:17431966-17431988 TGTGGTTTTCTAACAGATTCAGG - Intergenic
1201983366 Y:19931942-19931964 TGGGGTTTTATTTCAATGGCAGG - Intergenic