ID: 907877293

View in Genome Browser
Species Human (GRCh38)
Location 1:58503957-58503979
Sequence GGAAAGAATCAGTCAGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907877293_907877300 30 Left 907877293 1:58503957-58503979 CCAGAATCTGACTGATTCTTTCC No data
Right 907877300 1:58504010-58504032 AGCCACCATCATCTCCTACCAGG 0: 1
1: 4
2: 72
3: 281
4: 812
907877293_907877297 3 Left 907877293 1:58503957-58503979 CCAGAATCTGACTGATTCTTTCC No data
Right 907877297 1:58503983-58504005 TTTTCTGCTACCAGATATCTTGG 0: 1
1: 0
2: 1
3: 17
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907877293 Original CRISPR GGAAAGAATCAGTCAGATTC TGG (reversed) Intronic
No off target data available for this crispr