ID: 907882828

View in Genome Browser
Species Human (GRCh38)
Location 1:58567003-58567025
Sequence GGTATAAATAGACCATAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907882828_907882830 5 Left 907882828 1:58567003-58567025 CCTGCTTATGGTCTATTTATACC No data
Right 907882830 1:58567031-58567053 GTGTGACTGTTAATGTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907882828 Original CRISPR GGTATAAATAGACCATAAGC AGG (reversed) Intergenic
No off target data available for this crispr