ID: 907882830

View in Genome Browser
Species Human (GRCh38)
Location 1:58567031-58567053
Sequence GTGTGACTGTTAATGTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907882825_907882830 21 Left 907882825 1:58566987-58567009 CCTGAAGTGACCTAAGCCTGCTT No data
Right 907882830 1:58567031-58567053 GTGTGACTGTTAATGTTTCATGG No data
907882827_907882830 11 Left 907882827 1:58566997-58567019 CCTAAGCCTGCTTATGGTCTATT No data
Right 907882830 1:58567031-58567053 GTGTGACTGTTAATGTTTCATGG No data
907882828_907882830 5 Left 907882828 1:58567003-58567025 CCTGCTTATGGTCTATTTATACC No data
Right 907882830 1:58567031-58567053 GTGTGACTGTTAATGTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907882830 Original CRISPR GTGTGACTGTTAATGTTTCA TGG Intergenic
No off target data available for this crispr