ID: 907883635

View in Genome Browser
Species Human (GRCh38)
Location 1:58574093-58574115
Sequence CAGGCTCCAAACTTCCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907883635_907883639 2 Left 907883635 1:58574093-58574115 CCTGGAAGGAAGTTTGGAGCCTG 0: 1
1: 0
2: 2
3: 19
4: 176
Right 907883639 1:58574118-58574140 GGAGTTTCTCCCTTGATGAGTGG 0: 1
1: 0
2: 0
3: 7
4: 132
907883635_907883642 24 Left 907883635 1:58574093-58574115 CCTGGAAGGAAGTTTGGAGCCTG 0: 1
1: 0
2: 2
3: 19
4: 176
Right 907883642 1:58574140-58574162 GCAGCAGACTTTGAGATCTCTGG 0: 1
1: 0
2: 0
3: 7
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907883635 Original CRISPR CAGGCTCCAAACTTCCTTCC AGG (reversed) Intergenic
900078108 1:834342-834364 CCAGCTCCACACTTGCTTCCTGG - Intergenic
900264850 1:1752222-1752244 CAGGATTTAAACTACCTTCCTGG + Exonic
900611851 1:3547607-3547629 CAGGCCCCATCCTCCCTTCCTGG + Intronic
902828666 1:18995489-18995511 GAGGCTGCAGCCTTCCTTCCCGG - Intergenic
904377005 1:30087961-30087983 CAGACTCCACACTTGCTTTCTGG - Intergenic
904465554 1:30705226-30705248 CAGTCTCCTGACTTCGTTCCTGG - Intergenic
904750262 1:32737439-32737461 CAGGCTGGAAGTTTCCTTCCTGG + Intergenic
904872229 1:33625881-33625903 GATGCTCCAAACTACCTTTCTGG + Intronic
905454140 1:38075956-38075978 CAGGGTCCCCTCTTCCTTCCTGG - Intergenic
907883635 1:58574093-58574115 CAGGCTCCAAACTTCCTTCCAGG - Intergenic
909032166 1:70555161-70555183 CAGACTCCAAACATCTATCCAGG + Intergenic
911750010 1:101485543-101485565 CAGGCTCTAAACTTCCTTTTTGG + Intergenic
913059372 1:115190879-115190901 CAGGTTCCAAACCTATTTCCTGG - Intergenic
915383325 1:155464186-155464208 GAGCCTCCACACATCCTTCCAGG - Intronic
918348932 1:183634805-183634827 AAGGCTCCAAGCTTCCTTCTAGG + Intronic
918431047 1:184461122-184461144 CAGGCTTTGAACTTCCTTCTAGG + Intronic
918965221 1:191336848-191336870 CAGTATCCAAACTTCCTACTTGG + Intergenic
920257367 1:204664756-204664778 CACGCTACCAACTTCCTTCTTGG + Intronic
923026718 1:230210113-230210135 CGGGATCCAAACTCCTTTCCAGG + Intronic
1064938570 10:20707445-20707467 AAGGCTCCTAAATTCCCTCCTGG - Intergenic
1069772189 10:70907089-70907111 CAGGCTAGACACCTCCTTCCTGG - Intergenic
1069832761 10:71291187-71291209 CAGGCTCCTGACTCCCTCCCAGG + Intronic
1069943267 10:71969663-71969685 CAGTCCCCCAACTTCCGTCCTGG - Intronic
1070826173 10:79391695-79391717 CAGGCTCCAAGCTATCCTCCGGG + Intronic
1071160825 10:82743341-82743363 CAGGCTCCTAGCATCTTTCCAGG - Intronic
1071849352 10:89552680-89552702 CATACTCCCAACTTACTTCCTGG - Intronic
1075906140 10:126083536-126083558 AAGGTTCTACACTTCCTTCCAGG + Intronic
1077423960 11:2465847-2465869 CAGGCTCCAAATGGCCTTCCAGG - Intronic
1078040583 11:7858888-7858910 CAGGCTCCAAATTGCTTCCCTGG + Intergenic
1078143517 11:8708097-8708119 CAGGCTCCACCCTTCCTCCCAGG + Intronic
1079188708 11:18259892-18259914 CTGGATCCAAACTTTCTCCCTGG - Intergenic
1082122281 11:48392020-48392042 TTGGCTCCAACCTTCCTGCCAGG + Intergenic
1083652277 11:64210567-64210589 CTGGGTCCAACCTTCCTCCCTGG - Intronic
1083688481 11:64391956-64391978 CAGTTTCCAAACTACATTCCAGG - Intergenic
1083899848 11:65638302-65638324 CACCCTCCCAACTTCCCTCCGGG + Intronic
1084972297 11:72778555-72778577 CAGGGTCCCAGCCTCCTTCCTGG + Intronic
1088592378 11:111414840-111414862 CAGGCTTCAAGTTTCCTTCTAGG - Intronic
1090347509 11:126083053-126083075 AAGGCTCCAAACATTCTTACGGG - Intergenic
1090886314 11:130880072-130880094 TAGGCAACAAACTGCCTTCCTGG + Intronic
1094740739 12:33285428-33285450 CAGGCTCAAAATATCCCTCCTGG + Intergenic
1095473320 12:42559879-42559901 CAGGCTCCAAACTTCACACCTGG - Intronic
1098787929 12:74782662-74782684 CATGCTCCAGACTTTCTCCCAGG + Intergenic
1101011819 12:100458733-100458755 CTGGCTGAAATCTTCCTTCCTGG - Intergenic
1101048323 12:100834358-100834380 CAGCATCCAGACTTCCTTTCAGG - Intronic
1104416987 12:128603700-128603722 CAGCCTCCTCACTACCTTCCAGG + Intronic
1104462525 12:128967341-128967363 CAGCCTCCAAACTTTCATTCAGG + Intronic
1105247147 13:18664229-18664251 CAAATTCCAAACCTCCTTCCAGG + Intergenic
1106926121 13:34614927-34614949 CAGACTTCAATCTTTCTTCCTGG - Intergenic
1109211185 13:59537836-59537858 CTGGCTCCAAACTGCATTTCTGG - Intergenic
1110414589 13:75238160-75238182 GAAGCTCCAAACATCGTTCCTGG + Intergenic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1113174368 13:107545552-107545574 CAGGCTCCAACTGTCCTTCAGGG - Intronic
1114736916 14:25051152-25051174 CAGGCTCAAAAGTGCCTTCCGGG - Intergenic
1115905779 14:38201564-38201586 GAGGCTCCAAACCCACTTCCAGG - Intergenic
1117255559 14:53973661-53973683 CATGCTCCAATCTTCCTCCAGGG - Intergenic
1117373859 14:55103254-55103276 CAGTTTCCAAACTCCCATCCCGG + Intergenic
1118769915 14:68935863-68935885 CAGGCTCCAAACTCACGTGCTGG + Intronic
1123767968 15:23500674-23500696 TAATCTCCAAAATTCCTTCCTGG - Intergenic
1124570318 15:30856893-30856915 TAATCTCCAAAATTCCTTCCTGG + Intergenic
1128704295 15:69827460-69827482 CAGACTCGAAACTTCCTTATTGG - Intergenic
1128710551 15:69868264-69868286 CAGGCTCCATATTTCCTCTCTGG - Intergenic
1128885110 15:71279571-71279593 CACCCTCCACACTTCCCTCCTGG - Intronic
1133769010 16:8856968-8856990 CCCACCCCAAACTTCCTTCCTGG + Intronic
1135276622 16:21118849-21118871 CAGGCTGCAAAGTTCCTGCCTGG + Intronic
1136604133 16:31321248-31321270 CAGGCTCCAAGCTCTCTCCCAGG + Exonic
1139344893 16:66296543-66296565 CAGGCTCCAAACATGCTGTCTGG - Intergenic
1140472261 16:75222560-75222582 CTGGCTCCAGTCATCCTTCCAGG - Intronic
1141556448 16:84839645-84839667 CAGTGTGGAAACTTCCTTCCTGG + Intronic
1141742354 16:85902234-85902256 TATTATCCAAACTTCCTTCCTGG - Intronic
1142371778 16:89686629-89686651 CAGGCGCGAAAGCTCCTTCCCGG - Intronic
1143133968 17:4700203-4700225 CAGGCTCAAAACTTCATCCTCGG - Intronic
1148106154 17:45120114-45120136 CCGGCTCCCCACTCCCTTCCTGG + Intronic
1148324117 17:46773424-46773446 AAGGCCACAGACTTCCTTCCTGG - Intronic
1149098455 17:52873035-52873057 CAGGATACAAACTTGCTTCCCGG + Intronic
1150422513 17:65051223-65051245 CAGGCTCTATTCATCCTTCCAGG - Intronic
1154441697 18:14394891-14394913 CAAATTCCAAACCTCCTTCCAGG - Intergenic
1155181474 18:23351952-23351974 TAGGCTCCTTATTTCCTTCCTGG - Intronic
1156451766 18:37270605-37270627 CAGCCTCCCATCTTCCTTCAGGG - Intronic
1158558291 18:58492985-58493007 CAGCCTCCAAACTTCCTTAATGG + Intronic
1160585409 18:79911084-79911106 CAGGCTCTGCTCTTCCTTCCTGG - Intronic
1160847396 19:1172633-1172655 CAGGCTTCAAACTTTCTTCCAGG - Intronic
1161572481 19:5038172-5038194 CAGGCCCCACGCCTCCTTCCAGG - Intronic
1162334860 19:10054000-10054022 CAGACTCCAACTTTCCCTCCAGG + Intergenic
1163260943 19:16189601-16189623 CTGGCTCCACACTTCCTGGCTGG - Intronic
1163366964 19:16880814-16880836 CAAGCTCCACACCTGCTTCCGGG + Intergenic
1164748891 19:30636479-30636501 GAGGCTCCCTCCTTCCTTCCTGG + Intronic
1164789226 19:30961844-30961866 CAGGCTCCCTGCATCCTTCCTGG + Intergenic
1166361931 19:42256062-42256084 CAGGCTTCATCCTTCCCTCCCGG - Intergenic
1168193180 19:54755245-54755267 CAGGCTCCTATCTCCCCTCCAGG - Intronic
926142161 2:10374126-10374148 CAGGCTCCTTCCTTCCTTCAGGG + Intronic
926508567 2:13745337-13745359 CTGGCTACAGACTTCTTTCCAGG - Intergenic
928649786 2:33391985-33392007 CAGGCTCCAAAAGCCCTTGCTGG - Intronic
933403162 2:81824389-81824411 CAGGCTCTGAAATGCCTTCCTGG + Intergenic
934240288 2:90266025-90266047 CAGGCTCTAATTTTCCTGCCTGG + Intergenic
934947804 2:98554601-98554623 CAAGCTCCAGGTTTCCTTCCTGG + Intronic
937430629 2:121835227-121835249 CAGAATTCAAACTTCCTTCATGG + Intergenic
938123085 2:128647224-128647246 CATGTTCCAAACTTGCATCCTGG + Intergenic
938232022 2:129669498-129669520 CAGGGTCCACACACCCTTCCCGG + Intergenic
938528382 2:132160242-132160264 CAGGCTCCCGACATCCTGCCTGG + Intronic
939102530 2:137911811-137911833 CAAATTCCAAACCTCCTTCCAGG + Intergenic
939959489 2:148553839-148553861 CAGGCACCAACACTCCTTCCAGG + Intergenic
940052961 2:149483147-149483169 CAGGCTCCTGACATCCTGCCTGG - Intergenic
941814028 2:169782769-169782791 CAGTCTCCACACTGCTTTCCTGG + Intergenic
945621589 2:212146270-212146292 CAGACTGCAAACTGCCTTGCTGG + Intronic
948026531 2:234782431-234782453 CAGTCTGCCAACTTCGTTCCCGG + Intergenic
948258368 2:236584666-236584688 GGGGCTCCAGACATCCTTCCTGG - Intergenic
948619497 2:239225536-239225558 CAGGCTCCACCCCTCCATCCAGG - Intronic
1170448426 20:16455741-16455763 CAGGCTACAAACTGCCTGCCAGG + Intronic
1170473014 20:16687049-16687071 TAAGCTCTAAACTGCCTTCCAGG - Intergenic
1172645886 20:36469301-36469323 CAGGCTCCTAACCTGCATCCTGG + Intronic
1173013521 20:39204235-39204257 CAGGCTACACAATTCCTCCCAGG + Intergenic
1173401257 20:42728038-42728060 CTGGCTCCAGACGACCTTCCAGG + Intronic
1173921597 20:46750366-46750388 CAACCTCCAAATTTGCTTCCTGG + Intergenic
1175514400 20:59559711-59559733 TGGTCTCCAAACTGCCTTCCGGG - Intergenic
1176454370 21:6896282-6896304 CAAATTCCAAACCTCCTTCCAGG + Intergenic
1176832543 21:13761330-13761352 CAAATTCCAAACCTCCTTCCAGG + Intergenic
1176904645 21:14484609-14484631 TAATATCCAAACTTCCTTCCAGG - Intergenic
1177834325 21:26171981-26172003 CGGGGTACAGACTTCCTTCCTGG + Intergenic
1177917749 21:27111661-27111683 CATATTCCAAACTTCCTCCCTGG + Intergenic
1178515933 21:33247162-33247184 CTGGCTCCAGACTTCCTGTCAGG - Intronic
1178548469 21:33514331-33514353 CAGCCTCTAAAGTTTCTTCCAGG - Intronic
1179907774 21:44433178-44433200 CAGGCCCCTAACCTCCCTCCTGG + Intronic
1181182667 22:21078647-21078669 CAGCCTCCAGACTTCCTGTCGGG + Intergenic
1181674512 22:24442873-24442895 CAGGTTGCTAACTGCCTTCCAGG - Intergenic
1184058995 22:42070678-42070700 CAGGCTCCGGACTTCCAGCCGGG + Exonic
950471459 3:13189161-13189183 GTGGCTGCAAAGTTCCTTCCTGG - Intergenic
950725113 3:14912206-14912228 CAGGCTCCACACTTCTGCCCAGG - Intronic
951945605 3:28132374-28132396 AAGCCACCAAACTTCCTTCATGG + Intergenic
952831858 3:37571711-37571733 CAGGATCCAGACCTCCTTCATGG - Intronic
952889792 3:38032132-38032154 CAGGCTCCAAGCGTGCTTCAGGG + Intergenic
953920718 3:46949478-46949500 CTGGCTCCAAACTCCCTCCAGGG + Intronic
954697865 3:52437034-52437056 CTGGCCCCACACTTCCTCCCTGG - Intronic
957828510 3:85484153-85484175 CAGGCTACAAACTTTTTTCCAGG + Intronic
960987107 3:123287836-123287858 CAGGCTCCCAGCTGCCTGCCCGG + Intronic
961204438 3:125069654-125069676 GAGGTCCCCAACTTCCTTCCTGG + Intergenic
966297985 3:178445804-178445826 CAGGCTCAGACCTTCCCTCCTGG - Intronic
967197828 3:187044051-187044073 CAGTCTACAAACTCCCTTCCTGG - Intronic
968262480 3:197336077-197336099 CAAGGCTCAAACTTCCTTCCAGG - Intergenic
970005239 4:11404612-11404634 CAGGTTCAAACCTGCCTTCCTGG - Intronic
970323991 4:14904125-14904147 CAGTCTCCATCCTTTCTTCCTGG + Intergenic
970654440 4:18215625-18215647 CAGGGGCAAAGCTTCCTTCCTGG - Intergenic
975668493 4:76756536-76756558 CAGACTCCAAACTTCTATCAAGG + Exonic
982866687 4:160521891-160521913 CAGGATCCAAATTTTCATCCAGG - Intergenic
983708556 4:170687631-170687653 CAAGGTCCAAACGTCCTGCCTGG + Intergenic
990247472 5:53877453-53877475 CATGCTACAAACCTCCTTCTTGG + Intergenic
991466287 5:66915792-66915814 CTGGCTGCAGGCTTCCTTCCTGG + Intronic
996549795 5:124718070-124718092 CATTCTGCAAACTTCCTTGCTGG + Intronic
997773379 5:136575203-136575225 CAGGCACCAAGATTCCCTCCCGG - Intergenic
998472940 5:142397564-142397586 CATGCTCCAATCTTCCTGCATGG - Intergenic
998848654 5:146334460-146334482 CAGGCTCCAGGCATGCTTCCGGG - Intronic
1002419579 5:179138654-179138676 CAGGCTCCAGGCTGCCCTCCCGG - Intronic
1004457534 6:15804785-15804807 GAGTCTCCATCCTTCCTTCCAGG - Intergenic
1005023133 6:21436672-21436694 CAAGCTCCAAACTGGCTTCCTGG - Intergenic
1005417333 6:25614153-25614175 CAGGCTCCAAACGTTGTCCCTGG - Intronic
1006389954 6:33752367-33752389 CAGGCTGCCACCTGCCTTCCAGG + Intergenic
1007390281 6:41546624-41546646 CCGGCTCCGCTCTTCCTTCCCGG - Exonic
1008589131 6:52975748-52975770 CAGAAGCCAAACTTCCTCCCTGG + Intergenic
1008962498 6:57279945-57279967 CAGGCCCCAAACTTACTTCATGG - Intergenic
1009293600 6:61915092-61915114 AAGGCTCCAATCTTCCAGCCTGG - Intronic
1016143060 6:140637223-140637245 TTGGCTCCACACTTCATTCCCGG + Intergenic
1016377812 6:143441641-143441663 CATGATCCAAACTTCCCACCAGG + Intronic
1018169748 6:161135481-161135503 CAGGCTTCTGCCTTCCTTCCGGG - Exonic
1019925416 7:4188722-4188744 CAGGCTCCAGAATTAATTCCAGG - Intronic
1026025557 7:66741132-66741154 CCGGCTCCCACCTTCCGTCCAGG + Intronic
1035527510 8:325328-325350 CCAGCTCCACACTTGCTTCCTGG + Intergenic
1039921055 8:41895152-41895174 CAGGCTCCAAACTTCTTTCTCGG + Intronic
1040738391 8:50539720-50539742 CAGGCTCCAATTTCCCTGCCAGG - Intronic
1040837439 8:51747186-51747208 CCTGATCCAACCTTCCTTCCTGG + Intronic
1041460157 8:58102683-58102705 CAGCCTCCATTCTCCCTTCCTGG + Intronic
1042939045 8:74089129-74089151 CAGGGGCGAAGCTTCCTTCCTGG + Intergenic
1043322532 8:79007534-79007556 CAGTCTCCAGAGTGCCTTCCTGG - Intergenic
1044823636 8:96176501-96176523 CAGGGTCAAGACTGCCTTCCAGG + Intergenic
1045470957 8:102511670-102511692 CAGCCTCCAACATTCCTTGCTGG - Intergenic
1048012488 8:130469458-130469480 CAGGCTGCTAACTGCCTTCCAGG + Intergenic
1050560463 9:6829662-6829684 CAAGCTCTAACCATCCTTCCTGG - Intronic
1051181987 9:14420775-14420797 CAGTCCCGAAACTTCCTACCAGG + Intergenic
1053916652 9:42949051-42949073 CAGCATCCAAAGTTCCCTCCAGG + Intergenic
1053939946 9:43237977-43237999 CAGGCTCTAATTTTCCTGCCTGG + Intergenic
1054808190 9:69412748-69412770 CAGGCCCCAGACTCCTTTCCCGG + Intergenic
1055355030 9:75428806-75428828 CAGGCTCCGAAGTACATTCCAGG + Intergenic
1055834616 9:80423915-80423937 AAGGCCCCAAACTACATTCCTGG - Intergenic
1057528987 9:95827281-95827303 CAGTCTCCCCGCTTCCTTCCTGG + Intergenic
1060560655 9:124540032-124540054 CAGGCTCCACACTGTCTTCCAGG - Exonic
1060775261 9:126368386-126368408 CAGGCTCCAAAGCCCCTTCCTGG - Intronic
1061327875 9:129875113-129875135 AAGGCTCCAAGCTGCCTTCCTGG - Intronic
1061537335 9:131258303-131258325 CAGGCCCCAGGCTTCCTGCCAGG - Exonic
1062061326 9:134496872-134496894 CAGGCCCCGACCATCCTTCCAGG + Intergenic
1062433189 9:136535056-136535078 CAGGCCCCAGACCTCCTTCCAGG + Intronic
1185616016 X:1422552-1422574 CAGTCCCCAAGCTCCCTTCCAGG + Intronic
1186134547 X:6505281-6505303 CAAGCTCCAAGCATCCTTCTAGG - Intergenic
1186763290 X:12745601-12745623 CAGGGTCCATACCTCCTGCCAGG + Intergenic
1188197948 X:27262320-27262342 TTGGCTCCAAGCTTCCTTTCTGG - Intergenic
1189170601 X:38905807-38905829 CAGGCTGAAACCCTCCTTCCCGG - Intergenic
1190160842 X:48030399-48030421 CCGCCTCCAAATTTGCTTCCTGG + Intronic
1190975428 X:55395749-55395771 CAGGCTCCTTTCTTCCTTACAGG + Intergenic
1192260036 X:69500506-69500528 CAGGGTCAGGACTTCCTTCCTGG + Intergenic
1199497404 X:148468282-148468304 TTTGCTCCAGACTTCCTTCCTGG - Intergenic
1200112997 X:153752658-153752680 AAGGCTCTAAACTTCCCTCTCGG - Intergenic