ID: 907883635

View in Genome Browser
Species Human (GRCh38)
Location 1:58574093-58574115
Sequence CAGGCTCCAAACTTCCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907883635_907883642 24 Left 907883635 1:58574093-58574115 CCTGGAAGGAAGTTTGGAGCCTG No data
Right 907883642 1:58574140-58574162 GCAGCAGACTTTGAGATCTCTGG No data
907883635_907883639 2 Left 907883635 1:58574093-58574115 CCTGGAAGGAAGTTTGGAGCCTG No data
Right 907883639 1:58574118-58574140 GGAGTTTCTCCCTTGATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907883635 Original CRISPR CAGGCTCCAAACTTCCTTCC AGG (reversed) Intergenic