ID: 907888284

View in Genome Browser
Species Human (GRCh38)
Location 1:58614244-58614266
Sequence GTTTTTAAGGAGATCCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907888284_907888289 -2 Left 907888284 1:58614244-58614266 CCCTCCAGGATCTCCTTAAAAAC No data
Right 907888289 1:58614265-58614287 ACCCCAGCCAAGAGCTTCCTGGG No data
907888284_907888291 -1 Left 907888284 1:58614244-58614266 CCCTCCAGGATCTCCTTAAAAAC No data
Right 907888291 1:58614266-58614288 CCCCAGCCAAGAGCTTCCTGGGG No data
907888284_907888294 2 Left 907888284 1:58614244-58614266 CCCTCCAGGATCTCCTTAAAAAC No data
Right 907888294 1:58614269-58614291 CAGCCAAGAGCTTCCTGGGGAGG No data
907888284_907888288 -3 Left 907888284 1:58614244-58614266 CCCTCCAGGATCTCCTTAAAAAC No data
Right 907888288 1:58614264-58614286 AACCCCAGCCAAGAGCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907888284 Original CRISPR GTTTTTAAGGAGATCCTGGA GGG (reversed) Intergenic
No off target data available for this crispr