ID: 907888751

View in Genome Browser
Species Human (GRCh38)
Location 1:58618505-58618527
Sequence CAGGGGAAATACCCTAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907888751_907888764 29 Left 907888751 1:58618505-58618527 CCCTCCTTAGGGTATTTCCCCTG No data
Right 907888764 1:58618557-58618579 TGTCTGCTTTCCATCCAGTAGGG No data
907888751_907888763 28 Left 907888751 1:58618505-58618527 CCCTCCTTAGGGTATTTCCCCTG No data
Right 907888763 1:58618556-58618578 ATGTCTGCTTTCCATCCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907888751 Original CRISPR CAGGGGAAATACCCTAAGGA GGG (reversed) Intergenic
No off target data available for this crispr