ID: 907893091

View in Genome Browser
Species Human (GRCh38)
Location 1:58654625-58654647
Sequence TGTTATATAGAACACTGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907893091_907893094 12 Left 907893091 1:58654625-58654647 CCCCTACAGTGTTCTATATAACA 0: 1
1: 0
2: 0
3: 15
4: 176
Right 907893094 1:58654660-58654682 ATCTTTGATAAATTAAAATGTGG 0: 1
1: 1
2: 2
3: 45
4: 584

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907893091 Original CRISPR TGTTATATAGAACACTGTAG GGG (reversed) Intergenic
901918811 1:12521060-12521082 TGTTGTATTCAACAATGTAGAGG + Intergenic
903416338 1:23185811-23185833 TGGTATATAAAATACTGAAGGGG + Intergenic
907893091 1:58654625-58654647 TGTTATATAGAACACTGTAGGGG - Intergenic
908309559 1:62864989-62865011 TTTTATATAAAGCAGTGTAGTGG + Exonic
908855458 1:68421762-68421784 TGTAAAATAGAACATTATAGTGG - Intergenic
909881150 1:80880421-80880443 TTTTATACAGTATACTGTAGTGG + Intergenic
909894059 1:81043964-81043986 TGTAATATCGAAAACTGTAGTGG + Intergenic
910807062 1:91199169-91199191 TGTTTTATAGAAAGCTTTAGAGG - Intergenic
913124046 1:115768931-115768953 AGTTAGATACGACACTGTAGAGG + Intergenic
917655933 1:177125606-177125628 AGGTATATAAAACACTGTATTGG + Intronic
917823099 1:178786787-178786809 TGCTATATACAAGTCTGTAGTGG + Intronic
921748137 1:218761168-218761190 TGTTAAATAGAAAACTGTTTAGG + Intergenic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
923535205 1:234844163-234844185 TGTTATATAGAGCTTTGTACTGG - Intergenic
924498896 1:244617386-244617408 TGCTATAAAGAGCACTGCAGGGG + Intronic
1063134361 10:3203482-3203504 TTTTATGGAGAACAGTGTAGAGG - Intergenic
1063683521 10:8213340-8213362 TCTTATTTAGGACACTGTAAAGG + Intergenic
1066071207 10:31815351-31815373 TGCCAGATAGAGCACTGTAGAGG - Intronic
1068099857 10:52538977-52538999 AATTACATAGAACAATGTAGAGG - Intergenic
1068308438 10:55246850-55246872 TGTTATATATTAAACTGCAGAGG + Intronic
1068385029 10:56315672-56315694 GGTAATATAGCCCACTGTAGAGG - Intergenic
1069118700 10:64540282-64540304 TATTATGAAGAACACTGTTGAGG + Intergenic
1070281755 10:75054320-75054342 TTTTATAAACAACACTGCAGTGG - Intronic
1072283358 10:93890749-93890771 TGTAGGATAGAACACTGGAGAGG - Intergenic
1075619809 10:123917817-123917839 AGTTATATAGCACAGTGTTGAGG - Intronic
1079345604 11:19649360-19649382 TATTATAAAGAACACTGTCCTGG + Intronic
1079691929 11:23429309-23429331 TTATATATAAAAAACTGTAGAGG - Intergenic
1079984165 11:27182921-27182943 CATTAGATAGAGCACTGTAGAGG + Intergenic
1084024868 11:66441579-66441601 TATTAGAAAGAACACTGCAGAGG - Intronic
1084551695 11:69847317-69847339 TGGTGTATACAACAGTGTAGAGG - Intergenic
1085120536 11:73964716-73964738 TGTTACACAGGACACTGAAGAGG + Intronic
1092666323 12:10803424-10803446 TGTTATATATAATAAGGTAGAGG + Intergenic
1095450199 12:42323247-42323269 TATTATATAGAAGACTGTACTGG - Intronic
1097453061 12:59759744-59759766 TGAGATATAGAACAATGCAGTGG + Intronic
1098216696 12:68228035-68228057 TGTTATTTAGGACACTTTGGGGG - Intergenic
1099950635 12:89298570-89298592 TGTTATAGTTATCACTGTAGAGG - Intergenic
1102205691 12:111089371-111089393 TGTTTGATAACACACTGTAGGGG + Intronic
1105489034 13:20869770-20869792 TTTTATTTAGAGAACTGTAGAGG - Intronic
1106153934 13:27134534-27134556 TGTAATATGGAAGACTTTAGGGG - Intronic
1107302998 13:38985605-38985627 TGTTATAAATAACATTGTAATGG - Intronic
1110029763 13:70594535-70594557 TGCTAGATAGAACATTTTAGAGG - Intergenic
1111492743 13:89004346-89004368 TTTTGTATAAAAAACTGTAGTGG - Intergenic
1111740562 13:92199848-92199870 TGTTATATACAGCAGTCTAGAGG - Intronic
1113056981 13:106278733-106278755 TGTTCTACAGAACGCTGTAAAGG + Intergenic
1115112788 14:29843806-29843828 TGTTATAGAGAAAACAGTATGGG + Intronic
1116741936 14:48766684-48766706 TGCTATAGAGAACAATGTGGAGG + Intergenic
1117346206 14:54835355-54835377 TATTATAAATAACACTGCAGTGG - Intergenic
1117466946 14:56003245-56003267 TGTTAAATATAAGATTGTAGGGG + Intergenic
1117527153 14:56620308-56620330 TATTATAAAGAACAATGTTGTGG - Intronic
1117781727 14:59240029-59240051 TGTTTTACAGAAGACTGTATTGG - Intronic
1118071248 14:62248821-62248843 TACTATATAGAACTCTGAAGAGG + Intergenic
1120117777 14:80640639-80640661 TTTTAGATAGAACCCTGGAGAGG - Intronic
1121903323 14:97715048-97715070 TATTATGTATAACACTGTAATGG - Intergenic
1125034351 15:35106724-35106746 TGTGATACAGAACAGAGTAGGGG + Intergenic
1125146758 15:36479425-36479447 TGTTATGAATAACAATGTAGTGG - Intergenic
1131238568 15:90718156-90718178 TGTTACATAGTACACAGTAAGGG + Intronic
1133580812 16:7142739-7142761 TGTCATATACAAAACAGTAGAGG - Intronic
1137491566 16:48937420-48937442 TCTTAAATAGCACATTGTAGGGG + Intergenic
1144049130 17:11482913-11482935 AGTTAAATATAACACTATAGAGG + Intronic
1144186490 17:12801131-12801153 TGTTACATAGGAGTCTGTAGAGG - Intronic
1148536203 17:48441091-48441113 TGTTTTTTAGAACACTATACTGG - Intergenic
1150715009 17:67564649-67564671 TGTTATAAAGAACACTATGATGG - Intronic
1153191012 18:2538646-2538668 TGTTTTTTACAACACTGTATGGG + Exonic
1157173765 18:45432220-45432242 TGTCATGCAGAACACTGTACGGG - Intronic
1158499514 18:57987480-57987502 AGTTATAAAGAACACAGTAAAGG + Intergenic
1164677767 19:30113290-30113312 TGCTATATAAAACCCTTTAGTGG + Intergenic
1165239339 19:34451910-34451932 TGTTAAACAGAGCACAGTAGAGG + Intronic
925628615 2:5866684-5866706 TGCTTTATAGAACACTCTATAGG + Intergenic
928479527 2:31667904-31667926 AGTTAGAGAAAACACTGTAGAGG + Intergenic
928727631 2:34193090-34193112 TGGTATATAGATCAATATAGTGG + Intergenic
930199261 2:48537135-48537157 AGTTCTATTGAACACTGTACTGG - Intronic
933383848 2:81585069-81585091 TGTTATATAGCAAATTTTAGAGG + Intergenic
934956541 2:98626337-98626359 TTTTATATTGAACTGTGTAGAGG - Intronic
935390052 2:102541542-102541564 TCTTATAGAGAACACTGGACAGG - Intergenic
936021517 2:108998609-108998631 TTTTAGATAAATCACTGTAGAGG - Intergenic
937596122 2:123675928-123675950 TGCTATAAAAAACACTGTTGTGG + Intergenic
938601817 2:132850195-132850217 AGTTATAGACAACACTGTTGTGG - Intronic
939977801 2:148739203-148739225 TGTTATATAGAACTGTTTAGGGG - Intronic
941282753 2:163573546-163573568 TGTGATATAGAAAACTATACTGG - Intergenic
942919551 2:181354902-181354924 TTTAGTATAGAACACTGGAGTGG + Intergenic
945117250 2:206420039-206420061 TGTCATATATGACACTGTGGAGG - Intergenic
946429713 2:219618714-219618736 TGTTTTCTAGAACAGTGCAGTGG + Intergenic
946451778 2:219786125-219786147 TGATATATAGAACAGATTAGAGG + Intergenic
947114426 2:226753562-226753584 TTATATATAAAACACTGTAATGG - Intronic
947120868 2:226813387-226813409 TGTTAGATAGATCACTCTTGTGG + Intergenic
947521897 2:230852309-230852331 TGTTATAAACAACACTGCAATGG - Intergenic
948256674 2:236573662-236573684 TCTTATCTATACCACTGTAGAGG + Intronic
1171145142 20:22774871-22774893 TTGTATATAGAACAATGGAGAGG + Intergenic
1171204633 20:23269298-23269320 TCTTATATTGTACTCTGTAGGGG - Intergenic
1172105184 20:32512852-32512874 TATTATAAACAACACTGCAGGGG + Intronic
1173369341 20:42420819-42420841 TGTTGCAGAGAACACTGTAGTGG + Intronic
1173377572 20:42501254-42501276 TGTTACTTAAAACACTGTGGTGG - Intronic
1174522992 20:51146800-51146822 TGAAATAAAGAACAATGTAGAGG + Intergenic
1180764013 22:18232902-18232924 TGTGATATATAACACTTGAGGGG - Intergenic
1180771631 22:18391640-18391662 TGTGATATATAACACTTGAGGGG + Intergenic
1180803008 22:18641254-18641276 TGTGATATATAACACTTGAGGGG + Intergenic
1181218707 22:21354006-21354028 TGTGATATATAACACTTGAGGGG - Intergenic
1203233468 22_KI270731v1_random:132631-132653 TGTGATATATAACACTTGAGGGG + Intergenic
949687714 3:6596473-6596495 TATTATATAGCAAAATGTAGGGG - Intergenic
949771278 3:7581267-7581289 TGTTCTAGAGAACAATGTATTGG + Intronic
950951471 3:17004369-17004391 TGGAATACAGAATACTGTAGAGG + Intronic
951959286 3:28297655-28297677 TGTTTTCTAAAACACTGCAGAGG - Intronic
952312291 3:32201141-32201163 TAGTACATAGAACACTCTAGAGG + Intergenic
952747399 3:36794202-36794224 TGGTAAATAGAACAGTGTATTGG + Intergenic
953105983 3:39879418-39879440 TGGTATATTGAACATTGTGGAGG + Intronic
954252033 3:49375330-49375352 TGTTATATGGTATACTGAAGAGG + Intronic
955458688 3:59155010-59155032 TTTTCTATAGAACTCTGGAGTGG + Intergenic
959324596 3:104920543-104920565 TGTTATATACAGCGTTGTAGTGG - Intergenic
960543596 3:118887382-118887404 TATTATAAATAACACTGTAATGG - Intergenic
960933222 3:122875742-122875764 TATCAGATAGCACACTGTAGGGG - Intronic
963331641 3:143922215-143922237 TGTTATATGGAATACTGTGACGG + Intergenic
963979431 3:151520245-151520267 TGTTTTATAGAATACTGCAGAGG + Intergenic
965688211 3:171327826-171327848 TGTAATATAGAACAATGGAGTGG - Intronic
966265271 3:178033559-178033581 TGCTTTATAGAACAATGTAAAGG + Intergenic
966281489 3:178235525-178235547 TGCTATAAAAAACACTGTTGTGG + Intergenic
969203502 4:5624215-5624237 TGTTATAAAGAACACCATAATGG - Intronic
970738825 4:19208502-19208524 TGAAATATAAAACAGTGTAGTGG + Intergenic
973946785 4:55965376-55965398 TGTTGTATAGAACTCTGTATTGG + Intronic
973961627 4:56116479-56116501 GATTATATAGAACATTATAGAGG + Intergenic
974681719 4:65173078-65173100 TGTTATATACAACATAGTAAAGG + Intergenic
979386254 4:120068261-120068283 TGATATATACAACGCTGTACAGG - Intergenic
980640112 4:135566132-135566154 TTTTGTAGAGAACACTGTGGTGG + Intergenic
980894385 4:138847824-138847846 TGGAATATAGAACACTGCAAGGG - Intergenic
981351598 4:143736271-143736293 TTTTGTATACAACACTGTGGGGG + Intergenic
981932654 4:150207876-150207898 TGGTATAGAGACCACTGTAGTGG + Intronic
983331914 4:166340645-166340667 TGTTAGATGGATCTCTGTAGAGG - Intergenic
984397093 4:179215899-179215921 TGTTGTGTGGGACACTGTAGAGG - Intergenic
985414609 4:189723043-189723065 TTTTATATAGAACACCCTAATGG + Intergenic
986342189 5:6800235-6800257 TTTTGTATAAAAGACTGTAGAGG + Intergenic
986460976 5:7971979-7972001 TGTTATATTTAACAGTGTTGGGG - Intergenic
986680529 5:10229170-10229192 TGTTATACAGAACATTATTGGGG - Intronic
987292840 5:16524662-16524684 AGTTGTGTTGAACACTGTAGAGG + Intronic
989771740 5:45154027-45154049 TGTTATAGAGATTACGGTAGTGG - Intergenic
992151244 5:73905720-73905742 TATTATTAACAACACTGTAGAGG + Intronic
992633986 5:78709695-78709717 TCTTATATTGAACACAGCAGGGG + Intronic
992822838 5:80515416-80515438 TGATATAGAGAACACTGGACTGG - Intronic
993227926 5:85193113-85193135 TGTTCTATAAGACACTGTAGTGG + Intergenic
993520614 5:88895326-88895348 TATTATATAGAACACTGACAAGG - Intronic
994319446 5:98375091-98375113 TGTTACATACAACATAGTAGGGG + Intergenic
994601798 5:101914582-101914604 TCTGATGTAGGACACTGTAGTGG + Intergenic
995085097 5:108099265-108099287 GGGTACATAGAACATTGTAGGGG + Intronic
995101690 5:108317152-108317174 TGTTTTATAAAACCTTGTAGTGG - Intronic
995730123 5:115229894-115229916 GGGTATATAGAACACTGTCCTGG - Intronic
997311483 5:132887757-132887779 TGATATATAGTAAACTGAAGAGG - Intronic
998725790 5:145012694-145012716 TATTATATAATACACTATAGAGG + Intergenic
998793847 5:145795816-145795838 TGTTATATGGAATACCATAGAGG + Intronic
1000231153 5:159316493-159316515 TGTTATGTAGGACACTGTGCTGG - Intronic
1000903710 5:166937546-166937568 TGTTATATCAAACACTGTCGTGG - Intergenic
1003974720 6:11331441-11331463 TATTATATAAAACAGTGTGGCGG + Intronic
1007014707 6:38453479-38453501 TGTTTTATGGAATGCTGTAGAGG - Intronic
1010433727 6:75807321-75807343 TGTTTTCTAGTACACTGTTGAGG + Intronic
1010508784 6:76691842-76691864 AGGTATAAAGACCACTGTAGTGG + Intergenic
1013146009 6:107392900-107392922 TGGTATAAAGGACACTGTATTGG - Intronic
1014699598 6:124667946-124667968 TGTTATATAGAAGAATGTGTGGG - Intronic
1015956495 6:138604009-138604031 TGTCATACTGAACACTGTATTGG - Intronic
1016307739 6:142701015-142701037 TTTTATTTATAACTCTGTAGAGG - Intergenic
1018347580 6:162918080-162918102 TATTATCTTGAACACTGCAGTGG - Intronic
1019842955 7:3466788-3466810 AGTTAAATTGAACACTGTAAAGG + Intronic
1021841847 7:24727299-24727321 TGTTCTTTAGAAGAGTGTAGTGG - Intronic
1023334096 7:39150424-39150446 TGTTATACAAAACAGTGTGGAGG - Intronic
1025074194 7:55928266-55928288 TGTTATATTTAACACTGGAAAGG + Intronic
1027644398 7:80779048-80779070 TGTTATAGAGAGCACTGTGCTGG - Intronic
1028434303 7:90783849-90783871 TGCTATAGAGAATACTGTGGAGG + Intronic
1028881271 7:95882706-95882728 TGTTATATTGAACATTGGTGAGG + Intronic
1030173096 7:106624722-106624744 TGATATATAGGGCACTGTAAGGG - Intergenic
1030861605 7:114638393-114638415 TGTTCCATAGAACACTGTTTTGG + Intronic
1031510957 7:122649061-122649083 TGTGGTAGAGAACACTGTTGGGG - Intronic
1033002079 7:137517063-137517085 TTTTAGAAAGAATACTGTAGAGG - Intronic
1033133816 7:138768241-138768263 TGTTTTATAAAAGACTGAAGGGG + Intronic
1033283241 7:140020657-140020679 TCTTTTAAAGAACACTGTATCGG + Intergenic
1037656120 8:20885687-20885709 TGCTAAATAGAACTCTGAAGGGG + Intergenic
1038426451 8:27467230-27467252 TGTTGTAGAGAACAATGTCGGGG + Exonic
1039360754 8:36874351-36874373 TATTATATAGAATTCTGTGGGGG + Intronic
1046021096 8:108666029-108666051 TGTTGAATAGAAGACTGTGGAGG + Intronic
1050572895 9:6959921-6959943 TGTGGTATAAAATACTGTAGGGG + Intronic
1050817535 9:9834230-9834252 TGTGATTTAGAACCCTGTTGTGG - Intronic
1051393779 9:16596196-16596218 TGTTTTAAAGAACAGTGTAGAGG + Intronic
1052091364 9:24331983-24332005 TGTTATTTAGAATATTGAAGGGG - Intergenic
1052377661 9:27735658-27735680 TGCTAAATAAAACACTGGAGAGG - Intergenic
1053044674 9:34905394-34905416 TGTTGAATAAAACACTGTAGGGG + Intergenic
1056285445 9:85083141-85083163 TGTGCTAGAGACCACTGTAGGGG + Intergenic
1058120124 9:101129154-101129176 CATTATAGAGCACACTGTAGGGG + Intronic
1059588746 9:115634357-115634379 TGTAATATGGAACCCTGTATAGG - Intergenic
1060057973 9:120432110-120432132 TATTATAAAGAACACTGTACTGG - Intronic
1060787187 9:126460014-126460036 TGAGTTATAGAACACTGCAGAGG - Intronic
1062359796 9:136182298-136182320 TTTTATGAAGGACACTGTAGGGG + Intergenic
1186546507 X:10455575-10455597 TGCTGGATAGAACACTGCAGTGG - Intronic
1187526920 X:20062752-20062774 AGTAATAAAGAACTCTGTAGGGG + Intronic
1188150012 X:26661570-26661592 TATTATATATAAAACTGTAGTGG + Intergenic
1198453572 X:136792671-136792693 TGTTTTTTAGAACACTGTAAAGG - Intergenic
1199055763 X:143292545-143292567 TGTCATCTAGAACACTGAAAAGG + Intergenic
1200883667 Y:8246373-8246395 TGTATTATAGAACAGTGTTGGGG + Intergenic