ID: 907893901

View in Genome Browser
Species Human (GRCh38)
Location 1:58665523-58665545
Sequence TACCTGCCTGGTTATAAGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907893901_907893907 15 Left 907893901 1:58665523-58665545 CCTCACTTATAACCAGGCAGGTA 0: 1
1: 0
2: 0
3: 5
4: 96
Right 907893907 1:58665561-58665583 AAGGGATTATTTCGATTATAGGG 0: 1
1: 0
2: 0
3: 19
4: 136
907893901_907893904 -4 Left 907893901 1:58665523-58665545 CCTCACTTATAACCAGGCAGGTA 0: 1
1: 0
2: 0
3: 5
4: 96
Right 907893904 1:58665542-58665564 GGTAATCTGAGAATATGGTAAGG 0: 1
1: 0
2: 1
3: 5
4: 108
907893901_907893906 14 Left 907893901 1:58665523-58665545 CCTCACTTATAACCAGGCAGGTA 0: 1
1: 0
2: 0
3: 5
4: 96
Right 907893906 1:58665560-58665582 TAAGGGATTATTTCGATTATAGG 0: 1
1: 0
2: 0
3: 10
4: 85
907893901_907893905 -3 Left 907893901 1:58665523-58665545 CCTCACTTATAACCAGGCAGGTA 0: 1
1: 0
2: 0
3: 5
4: 96
Right 907893905 1:58665543-58665565 GTAATCTGAGAATATGGTAAGGG 0: 1
1: 0
2: 1
3: 9
4: 175
907893901_907893903 -9 Left 907893901 1:58665523-58665545 CCTCACTTATAACCAGGCAGGTA 0: 1
1: 0
2: 0
3: 5
4: 96
Right 907893903 1:58665537-58665559 AGGCAGGTAATCTGAGAATATGG 0: 1
1: 0
2: 0
3: 22
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907893901 Original CRISPR TACCTGCCTGGTTATAAGTG AGG (reversed) Exonic
901985037 1:13068700-13068722 TACCTGCCTGGTTCTTCCTGAGG + Exonic
901996773 1:13158070-13158092 TACCTGCCTGGTTCTTCCTGAGG - Intergenic
907893901 1:58665523-58665545 TACCTGCCTGGTTATAAGTGAGG - Exonic
907909093 1:58811570-58811592 TACCTGCCTGGTTCTCAAGGTGG + Intergenic
913133600 1:115865240-115865262 TACCTGCCAGATTCTGAGTGAGG + Intergenic
916879470 1:169005840-169005862 TAGCTGCTTGGATATGAGTGTGG + Intergenic
923828037 1:237521844-237521866 CACCAGCCTCATTATAAGTGAGG + Intronic
924261609 1:242237415-242237437 TACCTGCTTTGTGATAAGGGAGG + Intronic
1073096928 10:100985513-100985535 CACCCACCTGGTTGTAAGTGGGG - Exonic
1073783805 10:106866320-106866342 TCCCTGTCTGGTAATGAGTGGGG - Intronic
1075633514 10:124015549-124015571 TACCTGTCTGGGGAGAAGTGGGG - Intronic
1076152210 10:128171929-128171951 TACCTGCCTGTCTGTAACTGAGG + Intergenic
1079869584 11:25780923-25780945 GCCCTGCCTGGTGATGAGTGGGG - Intergenic
1082045679 11:47724465-47724487 TACCTGGCTAGTTACAACTGTGG + Exonic
1082615780 11:55357378-55357400 AGCCTGCCTGGTAATAAATGAGG - Intergenic
1086546265 11:87971123-87971145 TTCCTGCCTGATTATCAGTTTGG + Intergenic
1088700430 11:112406759-112406781 AGCCTGCCTGGTGATCAGTGGGG + Intergenic
1089135915 11:116248995-116249017 TAGGTGCCTGGTTAAAAGTCAGG - Intergenic
1096402106 12:51315871-51315893 TAATTGCCTGTTTATAAGTGAGG - Intronic
1099667710 12:85653395-85653417 TCCCTGTCTGGTGATGAGTGGGG + Intergenic
1100146670 12:91686817-91686839 TGCTTGCCTGGTTAGAGGTGAGG - Intergenic
1102195780 12:111024271-111024293 AACCTGACTGGTGATAACTGAGG - Intergenic
1106005350 13:25764883-25764905 TACCTGCCTGGTTGTCAAAGAGG - Intronic
1106787874 13:33125101-33125123 GACCAGCCTGATTCTAAGTGTGG + Intronic
1108249905 13:48553959-48553981 TTCTTGCCTGGTTCTAAGTGGGG + Intergenic
1108410532 13:50142056-50142078 TAGCTTCCTGGTTGTCAGTGTGG + Intronic
1114465660 14:22920472-22920494 AACATGCCTGGGTCTAAGTGAGG + Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1118616931 14:67580307-67580329 GACCTGCCTCTTTAAAAGTGTGG - Intronic
1118757863 14:68858342-68858364 CACCTGCCTGGTAATACCTGGGG + Intergenic
1127599717 15:60523314-60523336 TATCTGCATGGTTACAACTGAGG - Intronic
1131962592 15:97805177-97805199 TGGCTGCCTGGTTGTAAGGGAGG + Intergenic
1137424140 16:48363332-48363354 TACCTGGCTGGTGATAATTTGGG - Intronic
1141004710 16:80341350-80341372 TGCCTGCATGGTTGTGAGTGTGG + Intergenic
1142344991 16:89548162-89548184 TACCTGCCTGGGTATTTCTGGGG - Intronic
1146392170 17:32432617-32432639 GACCTGGCTGTTTAAAAGTGTGG - Intergenic
1148601001 17:48894073-48894095 TACCTGCTTTGGTATTAGTGTGG + Intronic
1158866594 18:61643677-61643699 CATCTGCCTGGTTTTCAGTGAGG + Intergenic
1159001217 18:62977145-62977167 TGCTTACCTGCTTATAAGTGTGG + Intronic
1160297787 18:77654052-77654074 TCCCTGCCTGGGTAGCAGTGGGG - Intergenic
925832189 2:7906834-7906856 CATCTGCCTTGTTATTAGTGTGG - Intergenic
926748571 2:16180398-16180420 TGCCTGCCTGATGATAAGTCAGG + Intergenic
927765469 2:25803391-25803413 TGACTGTCTGGTTATAATTGGGG - Intronic
929169403 2:38916647-38916669 TAGCTACATGGTTATAAATGAGG - Intronic
930690787 2:54361963-54361985 TATCTTCCTGGTTATATGAGTGG - Intronic
930698745 2:54438450-54438472 TGCCTGCATGATTAGAAGTGCGG - Intergenic
931293873 2:60903067-60903089 TACCTGCCTCTTTAAAAGTCTGG - Intronic
937236307 2:120433610-120433632 TACATGCCTGGTTGTCACTGGGG - Intergenic
939596222 2:144126446-144126468 TACCAACCTGGTTATGATTGTGG + Intronic
941258335 2:163262988-163263010 TACCTGCCTAGTTCCAAATGGGG - Intergenic
949019085 2:241730937-241730959 GACCTGCTTGTTTAAAAGTGTGG - Intergenic
1168818659 20:758569-758591 TACCTGCTTGGTTATATAGGAGG + Intergenic
1173349134 20:42228713-42228735 TACATGAGTGGTTATATGTGTGG - Intronic
1180748302 22:18107442-18107464 TTCCTCCCTGGGTATAAGTTTGG - Intronic
1181473556 22:23155273-23155295 TACCTGCCTTGTTCTAAGCCAGG + Intronic
1183620821 22:38971423-38971445 TACCTGCCTGGTACTTGGTGTGG + Intronic
1184511910 22:44938861-44938883 TGCCTTCCTGGTCATCAGTGAGG - Intronic
951394852 3:22152890-22152912 CACGTCCCTGGTTGTAAGTGTGG - Intronic
952052118 3:29396865-29396887 TCCCTGCCTGATTGTAAGTTAGG - Intronic
955200816 3:56850694-56850716 TACCTGCCTGGCACTATGTGAGG + Intronic
956105688 3:65815779-65815801 TACCTGCCTTGAAACAAGTGAGG - Intronic
961465693 3:127079756-127079778 TAGCTGCCTGCATATGAGTGAGG - Intergenic
965313514 3:167161681-167161703 TACCTGGATGGTTACATGTGGGG + Intergenic
965962585 3:174446123-174446145 TAACTGCTTGTTTATAAATGTGG + Intronic
966566427 3:181387141-181387163 TTGCTGACTGGTTATATGTGTGG - Intergenic
966894314 3:184431581-184431603 TAACTGGCTGTTTATAAATGTGG + Intronic
971500832 4:27316356-27316378 TACCTGCCTGGCTATTGCTGTGG - Intergenic
974449964 4:62041763-62041785 ACCCTTCCTGGTTATAAGTGTGG + Intronic
980890915 4:138814359-138814381 TATTTCCCTGGTTATTAGTGTGG - Intergenic
981158589 4:141470464-141470486 TACCTGCCTAGGTTTAAGAGTGG - Intergenic
981403812 4:144343480-144343502 TACAAGCCTGGTAATAAATGTGG + Intergenic
981766733 4:148259307-148259329 TAACTAACTGCTTATAAGTGAGG + Intronic
989185742 5:38624266-38624288 TACATGCCTGGGAATCAGTGTGG - Intergenic
990523748 5:56604939-56604961 TGCCTCCTTGGTTATAGGTGAGG + Intronic
990821897 5:59850689-59850711 TACCTGCAGGGTTATAACCGTGG + Intronic
991182230 5:63766183-63766205 TTCCTGCATAGTTCTAAGTGTGG - Intergenic
992618201 5:78566233-78566255 TACTTACCTGCATATAAGTGTGG - Intronic
993033102 5:82727207-82727229 TCCCTGCCTAGTTCTTAGTGAGG - Intergenic
1001116632 5:168946123-168946145 TACCTGGCTGGTTTTCAATGAGG + Intronic
1001397337 5:171426730-171426752 TACCCGCCTGGGTATCAGTGAGG + Intronic
1005359753 6:25020686-25020708 TACCTGTTTGGTAATAAGAGGGG - Intronic
1008036818 6:46753765-46753787 GCCCTGCCTGGTTACTAGTGTGG + Exonic
1009878465 6:69535594-69535616 TTCCTGCCTGGTTTTGAGTGAGG - Intergenic
1010875449 6:81099312-81099334 TACCAGCCAGGTGATAAGTAAGG - Intergenic
1011579768 6:88847821-88847843 TCCTTTCCTGGTTATATGTGTGG - Intronic
1014103064 6:117533055-117533077 GAACTGCCTGTTTATATGTGTGG - Intronic
1015232507 6:130932273-130932295 TACTTTCCTGGATAGAAGTGTGG - Intronic
1022127660 7:27373777-27373799 TTCCTTCCTGGTAAAAAGTGGGG + Intergenic
1022508896 7:30922885-30922907 CAGCTGCGTGGTTAAAAGTGGGG + Intronic
1024083245 7:45873094-45873116 TACCTACCTGGGCCTAAGTGGGG - Intergenic
1024247912 7:47484442-47484464 TACCTGCCTTAGTATAAGGGAGG - Intronic
1031027879 7:116700301-116700323 TACCTCACAGTTTATAAGTGGGG - Intronic
1033515964 7:142106357-142106379 TACCTAATTGGTTATAGGTGGGG + Exonic
1037388311 8:18365899-18365921 ACCCTGCCTGGTGATAAGTAGGG - Intergenic
1042655549 8:71091664-71091686 TAATTGCCTGGTAATGAGTGAGG - Intergenic
1050878787 9:10674458-10674480 GCCCTGCCTGGTGATGAGTGGGG + Intergenic
1050986749 9:12092137-12092159 GTCCTGCCTGGTGAGAAGTGAGG + Intergenic
1054715140 9:68549768-68549790 TACTTTCCTTATTATAAGTGGGG - Intergenic
1188678497 X:32972813-32972835 TTAATGCCTGATTATAAGTGAGG + Intronic
1193496464 X:82219462-82219484 TCCCTGCCTGGTGAAGAGTGGGG + Intergenic
1195523129 X:105853405-105853427 TTAGTGCCTGGTTCTAAGTGAGG - Intronic
1199168480 X:144706472-144706494 TTTCTGCCTGGTTAAAAATGTGG - Intergenic