ID: 907895663

View in Genome Browser
Species Human (GRCh38)
Location 1:58687797-58687819
Sequence AGGTATCGGCAGAAGAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907895663_907895674 22 Left 907895663 1:58687797-58687819 CCAGACCTCTTCTGCCGATACCT No data
Right 907895674 1:58687842-58687864 CAGCAGCGGGCTCTGGCATTAGG 0: 1
1: 1
2: 8
3: 19
4: 169
907895663_907895673 15 Left 907895663 1:58687797-58687819 CCAGACCTCTTCTGCCGATACCT No data
Right 907895673 1:58687835-58687857 CTATAAGCAGCAGCGGGCTCTGG No data
907895663_907895671 9 Left 907895663 1:58687797-58687819 CCAGACCTCTTCTGCCGATACCT No data
Right 907895671 1:58687829-58687851 CCCAGGCTATAAGCAGCAGCGGG No data
907895663_907895669 8 Left 907895663 1:58687797-58687819 CCAGACCTCTTCTGCCGATACCT No data
Right 907895669 1:58687828-58687850 CCCCAGGCTATAAGCAGCAGCGG 0: 1
1: 3
2: 10
3: 42
4: 299
907895663_907895675 26 Left 907895663 1:58687797-58687819 CCAGACCTCTTCTGCCGATACCT No data
Right 907895675 1:58687846-58687868 AGCGGGCTCTGGCATTAGGTTGG No data
907895663_907895666 -8 Left 907895663 1:58687797-58687819 CCAGACCTCTTCTGCCGATACCT No data
Right 907895666 1:58687812-58687834 CGATACCTATAAATTGCCCCAGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907895663 Original CRISPR AGGTATCGGCAGAAGAGGTC TGG (reversed) Intronic
No off target data available for this crispr