ID: 907902628

View in Genome Browser
Species Human (GRCh38)
Location 1:58754998-58755020
Sequence GAGGAAACTGAGCTTCCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907902628_907902632 23 Left 907902628 1:58754998-58755020 CCTCCCGGAAGCTCAGTTTCCTC No data
Right 907902632 1:58755044-58755066 ATCTCCACCATCTCCCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907902628 Original CRISPR GAGGAAACTGAGCTTCCGGG AGG (reversed) Intergenic