ID: 907904074

View in Genome Browser
Species Human (GRCh38)
Location 1:58768266-58768288
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907904074_907904077 8 Left 907904074 1:58768266-58768288 CCATATGTCCAAGTCTTCAGCTA No data
Right 907904077 1:58768297-58768319 AAATCATAGAATTGCTTCTAAGG No data
907904074_907904078 25 Left 907904074 1:58768266-58768288 CCATATGTCCAAGTCTTCAGCTA No data
Right 907904078 1:58768314-58768336 CTAAGGTTGTAATTCCGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907904074 Original CRISPR TAGCTGAAGACTTGGACATA TGG (reversed) Intergenic