ID: 907904075

View in Genome Browser
Species Human (GRCh38)
Location 1:58768274-58768296
Sequence TGGTGTCATAGCTGAAGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907904075_907904077 0 Left 907904075 1:58768274-58768296 CCAAGTCTTCAGCTATGACACCA No data
Right 907904077 1:58768297-58768319 AAATCATAGAATTGCTTCTAAGG No data
907904075_907904078 17 Left 907904075 1:58768274-58768296 CCAAGTCTTCAGCTATGACACCA No data
Right 907904078 1:58768314-58768336 CTAAGGTTGTAATTCCGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907904075 Original CRISPR TGGTGTCATAGCTGAAGACT TGG (reversed) Intergenic