ID: 907904075 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:58768274-58768296 |
| Sequence | TGGTGTCATAGCTGAAGACT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 907904075_907904077 | 0 | Left | 907904075 | 1:58768274-58768296 | CCAAGTCTTCAGCTATGACACCA | No data | ||
| Right | 907904077 | 1:58768297-58768319 | AAATCATAGAATTGCTTCTAAGG | No data | ||||
| 907904075_907904078 | 17 | Left | 907904075 | 1:58768274-58768296 | CCAAGTCTTCAGCTATGACACCA | No data | ||
| Right | 907904078 | 1:58768314-58768336 | CTAAGGTTGTAATTCCGTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 907904075 | Original CRISPR | TGGTGTCATAGCTGAAGACT TGG (reversed) | Intergenic | ||