ID: 907904076

View in Genome Browser
Species Human (GRCh38)
Location 1:58768294-58768316
Sequence TAGAAGCAATTCTATGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907904076_907904078 -3 Left 907904076 1:58768294-58768316 CCAAAATCATAGAATTGCTTCTA No data
Right 907904078 1:58768314-58768336 CTAAGGTTGTAATTCCGTCTTGG No data
907904076_907904082 29 Left 907904076 1:58768294-58768316 CCAAAATCATAGAATTGCTTCTA No data
Right 907904082 1:58768346-58768368 TGAGCCTTGGCTGGTTGAGTTGG No data
907904076_907904080 16 Left 907904076 1:58768294-58768316 CCAAAATCATAGAATTGCTTCTA No data
Right 907904080 1:58768333-58768355 TTGGAATTTATTTTGAGCCTTGG No data
907904076_907904081 20 Left 907904076 1:58768294-58768316 CCAAAATCATAGAATTGCTTCTA No data
Right 907904081 1:58768337-58768359 AATTTATTTTGAGCCTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907904076 Original CRISPR TAGAAGCAATTCTATGATTT TGG (reversed) Intergenic