ID: 907904078

View in Genome Browser
Species Human (GRCh38)
Location 1:58768314-58768336
Sequence CTAAGGTTGTAATTCCGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907904074_907904078 25 Left 907904074 1:58768266-58768288 CCATATGTCCAAGTCTTCAGCTA No data
Right 907904078 1:58768314-58768336 CTAAGGTTGTAATTCCGTCTTGG No data
907904075_907904078 17 Left 907904075 1:58768274-58768296 CCAAGTCTTCAGCTATGACACCA No data
Right 907904078 1:58768314-58768336 CTAAGGTTGTAATTCCGTCTTGG No data
907904076_907904078 -3 Left 907904076 1:58768294-58768316 CCAAAATCATAGAATTGCTTCTA No data
Right 907904078 1:58768314-58768336 CTAAGGTTGTAATTCCGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907904078 Original CRISPR CTAAGGTTGTAATTCCGTCT TGG Intergenic
No off target data available for this crispr