ID: 907904252

View in Genome Browser
Species Human (GRCh38)
Location 1:58769848-58769870
Sequence CCCTTTGAAGACTTCTTCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907904252_907904256 -10 Left 907904252 1:58769848-58769870 CCACCGAAGAAGTCTTCAAAGGG No data
Right 907904256 1:58769861-58769883 CTTCAAAGGGACACGGTTTCAGG No data
907904252_907904257 1 Left 907904252 1:58769848-58769870 CCACCGAAGAAGTCTTCAAAGGG No data
Right 907904257 1:58769872-58769894 CACGGTTTCAGGTCTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907904252 Original CRISPR CCCTTTGAAGACTTCTTCGG TGG (reversed) Intergenic
No off target data available for this crispr