ID: 907905248

View in Genome Browser
Species Human (GRCh38)
Location 1:58778561-58778583
Sequence CTGCATTAGTGGAGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 1, 2: 1, 3: 39, 4: 287}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907905242_907905248 3 Left 907905242 1:58778535-58778557 CCCATTTAATGTAAGAAGATGCT 0: 1
1: 0
2: 1
3: 15
4: 269
Right 907905248 1:58778561-58778583 CTGCATTAGTGGAGGCAGGAAGG 0: 1
1: 1
2: 1
3: 39
4: 287
907905243_907905248 2 Left 907905243 1:58778536-58778558 CCATTTAATGTAAGAAGATGCTC 0: 1
1: 0
2: 1
3: 32
4: 244
Right 907905248 1:58778561-58778583 CTGCATTAGTGGAGGCAGGAAGG 0: 1
1: 1
2: 1
3: 39
4: 287
907905241_907905248 29 Left 907905241 1:58778509-58778531 CCTTCAAAACTAATGTTTCAGGC 0: 1
1: 0
2: 0
3: 12
4: 183
Right 907905248 1:58778561-58778583 CTGCATTAGTGGAGGCAGGAAGG 0: 1
1: 1
2: 1
3: 39
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907905248 Original CRISPR CTGCATTAGTGGAGGCAGGA AGG Intergenic
900172292 1:1274856-1274878 CGGCAGTAATGGAGGCAGGCTGG - Intergenic
900238386 1:1603278-1603300 CAGCATTAGTGGAGACATGGGGG + Intergenic
900500804 1:3003639-3003661 CTGCAGCTGTGGAGGCAGCACGG - Intergenic
900520872 1:3104962-3104984 GTGCATGGGAGGAGGCAGGATGG + Intronic
901204349 1:7485309-7485331 CTGCCTTAGGGGAGACAAGAAGG + Intronic
901234558 1:7661023-7661045 CTGCAAAAGTGCAGGGAGGAAGG + Intronic
901683016 1:10926476-10926498 CAGGATTGGTGGAGGCAGCAAGG - Intergenic
902124752 1:14199429-14199451 ATGCAATAGTGTAGTCAGGAAGG - Intergenic
903178793 1:21595250-21595272 CTGCACCAGTGGAGGGAGGAGGG - Intergenic
903889780 1:26561670-26561692 CTGGATTCGGGGAGGCAGTAGGG + Intronic
904270266 1:29345185-29345207 CTACATTATGGGAGGAAGGATGG - Intergenic
905497481 1:38403950-38403972 CTGCTTTTGTGGAGGTAGCAGGG - Intergenic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
907905248 1:58778561-58778583 CTGCATTAGTGGAGGCAGGAAGG + Intergenic
907911804 1:58833729-58833751 CTGTAAAAGTGGAGGCAGGAAGG + Intergenic
908140846 1:61183367-61183389 TTGCAGTAGTGGTGGCAGGGTGG + Intronic
908621393 1:65984311-65984333 AGGGATTAGTGGTGGCAGGAAGG + Intronic
908946755 1:69507780-69507802 TTGCTTTAGTGGGGGCAGGATGG + Intergenic
910053809 1:83007889-83007911 ATGCAGCAGTGGAGGCAGCACGG - Intergenic
912092535 1:106098313-106098335 CAGCATTACAGAAGGCAGGATGG + Intergenic
912612392 1:111061765-111061787 CTGCTTCAGTGGAGGAAGCAGGG + Intergenic
913517402 1:119616123-119616145 CTGCATAAATGGAGACAGGCAGG + Intergenic
915080839 1:153350795-153350817 ATGCATTATTTGAGGCAGGTCGG - Intergenic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
917103605 1:171470271-171470293 CTGAATTTGTGCTGGCAGGATGG + Intergenic
918446609 1:184623340-184623362 TTTCTTTAGGGGAGGCAGGAAGG - Exonic
921687680 1:218108990-218109012 GTTCCTTAGTGGAGGCAGGCTGG - Intergenic
924408873 1:243782482-243782504 CTGCATAAATGGGGGCAAGAAGG - Intronic
1064211493 10:13363895-13363917 TTTAATTAGTGGAGGCAGGACGG - Intergenic
1065462404 10:25982553-25982575 CTGCACTGGTGGAGGTAGCAGGG - Intronic
1068084403 10:52357043-52357065 CTGCTTTAGTGGCGGCGGGGGGG - Intergenic
1069571845 10:69498912-69498934 CAGCATTAGTGGAGGCAGGCAGG + Intronic
1070393978 10:75995751-75995773 CTAAATTACTGCAGGCAGGAAGG - Intronic
1071072271 10:81708614-81708636 ATGCATGAGTGGAAGCCGGAGGG - Intergenic
1071311751 10:84349422-84349444 CAGCACTTGGGGAGGCAGGAGGG + Intronic
1071326494 10:84523793-84523815 CTGCCTTAGAGCAGGCAAGATGG + Intergenic
1071524221 10:86348874-86348896 CTGCATGAGTGCAGCCAGGATGG - Intronic
1072274847 10:93812974-93812996 CTGCATTAGTGTACTCAGAAGGG + Intergenic
1074123741 10:110512162-110512184 CTGCGTAGGTGGAGGAAGGAAGG + Intergenic
1074364224 10:112845252-112845274 CTGCACAAGTTGGGGCAGGACGG + Intergenic
1075053267 10:119199035-119199057 CTGCATCACAGGAGGGAGGAAGG - Intergenic
1076490640 10:130859128-130859150 GTGCATTGGAGGAGGAAGGAAGG + Intergenic
1077817690 11:5703194-5703216 CTACACTAGGGGAGGGAGGAGGG - Intronic
1078610087 11:12812228-12812250 CTGAATAAGTGGTGGCAAGAGGG - Intronic
1080913689 11:36632001-36632023 CTGCATTAATGCAGGAAGCAAGG + Intronic
1081737268 11:45412739-45412761 CTGCAATAGTCCAGGCAGGGAGG - Intergenic
1081997090 11:47372713-47372735 CTGCATTCCTCAAGGCAGGAGGG - Intronic
1082079707 11:48002806-48002828 CTGCTTTAGTTGAGGCAGGCAGG + Intronic
1082204255 11:49412676-49412698 TTGCAGTGGTGGTGGCAGGAAGG - Intergenic
1084045489 11:66565646-66565668 ATGCATTAATGGGGTCAGGAGGG - Intronic
1084147057 11:67270553-67270575 CTGCAGGAGTGAAGGAAGGAGGG - Intronic
1084322524 11:68381551-68381573 CTGCATGCGTGCAGGGAGGAAGG + Intronic
1084754341 11:71225420-71225442 CGGCATTAGTATAGGCAGCATGG + Intronic
1086650833 11:89287853-89287875 TTGCAGTGGTGGTGGCAGGAAGG + Intronic
1086876124 11:92097616-92097638 TTGGATTAGTGGGGGAAGGAAGG + Intergenic
1087560769 11:99786615-99786637 CTGCATTAATGGAAACAGCATGG + Intronic
1088904388 11:114143244-114143266 CAGCATTAGTGGATGGATGAGGG - Intronic
1088993346 11:114973572-114973594 CTGCATGAGTGGGGAAAGGAAGG - Intergenic
1089004908 11:115083391-115083413 CTGCATGGAGGGAGGCAGGAAGG - Intergenic
1090253436 11:125266496-125266518 ATGGATGTGTGGAGGCAGGAAGG + Intronic
1092260697 12:6951930-6951952 GTGCAGGAGTAGAGGCAGGAGGG - Intronic
1092294614 12:7188668-7188690 GTGCATGAGCGGAGGCAGGCAGG - Intronic
1093948432 12:25136165-25136187 CTGCTCTAGTGGAGGTAGCAGGG - Intronic
1096399034 12:51290001-51290023 CTTCTTTAGTGGGGGCAGGAGGG - Intronic
1097183672 12:57185033-57185055 GGGCATCAGTGGAGGCAGGAGGG - Intronic
1097278575 12:57830050-57830072 CTGGCTTAGTGGAGGCAGAACGG + Intronic
1099930802 12:89072182-89072204 GTGCGTTAGTAGTGGCAGGAGGG + Intergenic
1104300200 12:127558004-127558026 CTTCTTTAGTAGAGGCAGGATGG - Intergenic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1105302905 13:19151629-19151651 CTGCTTCAGTGCAGGCAGGGTGG + Intergenic
1105598814 13:21866836-21866858 CTGCTCTAGTGGAGGTAGCAGGG + Intergenic
1106104512 13:26722465-26722487 CTCCATCAGTGGAGGCTGGTGGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107418577 13:40223919-40223941 CCACATCAGTGGAGGAAGGACGG - Intergenic
1107528622 13:41259746-41259768 GCGCATTAGTGGAACCAGGAAGG - Intronic
1108831714 13:54487334-54487356 CTGCTCTGGTGGAGGCAGCAGGG - Intergenic
1110361285 13:74628622-74628644 ATGCAGTTGTGGAGGCAGAATGG + Intergenic
1111018000 13:82405953-82405975 CACCCTTAGTTGAGGCAGGAAGG - Intergenic
1112605724 13:100904097-100904119 CTTCATTAGGTGAGACAGGAAGG + Intergenic
1113610681 13:111642777-111642799 CTGTAAAAGTGGAGGCAGAAAGG - Intronic
1113955595 13:114098626-114098648 CGGGATGAGGGGAGGCAGGAAGG + Intronic
1115938092 14:38577926-38577948 CTGCTCTAGTGGAGGTAGCAGGG + Intergenic
1116044816 14:39731850-39731872 CTGCACTGGTGGAGGTAGCAGGG + Intergenic
1116455227 14:45112752-45112774 CTGAATGAGAGAAGGCAGGAAGG + Intronic
1117283672 14:54265316-54265338 ATGCAGGAGTGCAGGCAGGATGG - Intergenic
1117671948 14:58117057-58117079 CTGGAGAAGTGGAGGCAGGAGGG - Intronic
1117890571 14:60417629-60417651 ATGCATTAAAGGAGGTAGGAAGG + Intronic
1118140149 14:63071993-63072015 CTGCTCCAGTGGAGGCAGCAAGG + Intronic
1118891978 14:69917955-69917977 CCACATTACTAGAGGCAGGAAGG - Intronic
1121720936 14:96108269-96108291 CTCCAGCAGTGGAGGCAGGTGGG - Intergenic
1122126301 14:99580360-99580382 GTGCAGTGGGGGAGGCAGGAGGG + Intronic
1124397839 15:29320088-29320110 CTGCCTTAGGTGAGACAGGAAGG - Intronic
1124689754 15:31812063-31812085 CTGCACTGGTGGAAGCAGCAGGG + Intronic
1124715367 15:32055560-32055582 CTGCATTAGTCCATTCAGGAGGG + Intronic
1125182500 15:36893745-36893767 CTGCATTAGTAAAGGAAGGAAGG + Intronic
1126850370 15:52793071-52793093 TTGCATGTGTGGAGGGAGGACGG + Intergenic
1127216455 15:56828292-56828314 CTGCATTCTAGGTGGCAGGAAGG + Intronic
1127661409 15:61103260-61103282 CTGCTTTGGGGCAGGCAGGAGGG + Intronic
1128213281 15:65916911-65916933 CTGCATGCGTGGAAGCAGGCGGG + Exonic
1128346024 15:66852850-66852872 CTGCAGTATAGGAGTCAGGATGG + Intergenic
1128497611 15:68207267-68207289 CTGCATTCCTGGGGGCTGGAGGG - Exonic
1129482193 15:75835854-75835876 CAGCATCACTGGAGTCAGGAGGG + Intergenic
1129529116 15:76248273-76248295 GTGCATTAGTGGAGGAGAGAGGG + Intronic
1129976499 15:79826586-79826608 TTACATTAGTGGAGGGAGGAAGG + Intergenic
1130109730 15:80954372-80954394 CTTCAGTACTGGAGGCAGGAGGG - Intronic
1130689259 15:86066484-86066506 CTGCTTCAGTGAAGGCTGGAGGG - Intergenic
1133407555 16:5537495-5537517 CTTCCTTACTGGAGGCTGGAGGG + Intergenic
1134411359 16:14005036-14005058 CTGCATGACTGGAGGTGGGAAGG + Intergenic
1135040425 16:19113851-19113873 CTGCCTTCGGGGAGGGAGGATGG + Intergenic
1135168887 16:20165622-20165644 GTGCATTAGGGGTTGCAGGAAGG - Intergenic
1135644240 16:24147328-24147350 CAGCATATGTGGAGGCAGAAAGG + Intronic
1137071277 16:35906929-35906951 CTTAGTTAGCGGAGGCAGGAGGG + Intergenic
1138024411 16:53511557-53511579 CAGTATTAGTGGAGTCAGGCAGG + Intergenic
1138037155 16:53620479-53620501 CTGTATTAGTGGAGACAGAATGG - Intronic
1139297162 16:65911118-65911140 CTAGATTAGTGGAGGCAGTATGG - Intergenic
1139651874 16:68366255-68366277 CTGCAGCAGTGAAGGAAGGACGG - Intronic
1141142389 16:81505151-81505173 CTGCTGTCCTGGAGGCAGGACGG + Intronic
1142852313 17:2710237-2710259 CTGAATCAGTGGGGGCAGGCTGG - Intronic
1142908926 17:3070656-3070678 AAGCTTTAGTGGAGGTAGGATGG + Intergenic
1142925639 17:3233586-3233608 AAGCTTTAGTGGAGGTAGGATGG - Intergenic
1143830583 17:9647281-9647303 CTTCACTAATGGAGGCAGGAGGG - Intronic
1144026706 17:11283440-11283462 GTGCTTTAATAGAGGCAGGATGG - Intronic
1145813037 17:27776172-27776194 CTGCATGAGTCAAGGCAGGGAGG + Intronic
1146589220 17:34114041-34114063 CTGCCTCAGAGGAGACAGGAAGG + Intronic
1147646612 17:42038123-42038145 CTGCCTCAGTAGGGGCAGGAGGG - Intronic
1147689103 17:42304666-42304688 CTGGAGCAGTGGGGGCAGGAGGG - Intronic
1147904976 17:43816726-43816748 CAGCATTAGTGGAGGGAAGCGGG + Intronic
1147988965 17:44321885-44321907 CTGCATGTGTAGAGGCAGGGAGG - Intronic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1150916397 17:69441962-69441984 CAGCATCAGTGGAGGCCAGATGG - Intronic
1151971163 17:77458192-77458214 CTGAATGAGTGAGGGCAGGAGGG - Intronic
1153342410 18:3989027-3989049 GTGCAGCAGTGGAGGCAGGAGGG - Intronic
1153833136 18:8940716-8940738 CTGATTCAGTGGAGACAGGAGGG - Intergenic
1153964616 18:10168257-10168279 CTGGGATAGTGGAGGCAGGGTGG + Intergenic
1153995633 18:10439403-10439425 CTGCCTTAGTTGGGACAGGAAGG - Intergenic
1157092537 18:44653065-44653087 CTGCATTGGTGGAGGCAGGAGGG - Intergenic
1157493415 18:48139171-48139193 GTGCGGGAGTGGAGGCAGGAGGG + Intronic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158956068 18:62540189-62540211 CTGCATTATTGCAGGAAGAATGG - Intronic
1160053345 18:75456586-75456608 CTGCAGTACTGGAAACAGGAAGG - Intergenic
1160392040 18:78541180-78541202 CTGCATTCCGGGAGGCACGAGGG - Intergenic
1160463287 18:79055453-79055475 CGGCACTGGAGGAGGCAGGAAGG - Intergenic
1161369827 19:3904755-3904777 CCTCATGAGTGGAGACAGGAGGG + Intronic
1161370709 19:3909392-3909414 CGGCAGGAGTGGAGGCAGGCAGG + Intronic
1161569564 19:5023116-5023138 CCTCATGAGAGGAGGCAGGAGGG + Intronic
1163690842 19:18737366-18737388 CAGCATCAGTGGAGGCACGTGGG - Intronic
1164073776 19:21793955-21793977 CTGCAGTAGAGGACACAGGATGG - Intergenic
1166298037 19:41898130-41898152 CTGCCTTAGTGGATGGGGGAAGG - Intronic
1166585955 19:43949231-43949253 CAGCAGTGGTGGAGGCAGCATGG + Intergenic
1167697383 19:51023265-51023287 CTGCATTAGGGGAGGTGGCAGGG - Intronic
925039980 2:725052-725074 CTGCAGTACTTGTGGCAGGATGG - Intergenic
925132237 2:1502202-1502224 CTGCATAACGGGATGCAGGAGGG + Intronic
925684832 2:6459484-6459506 CGGCATTAGTGGCTGCAGCAGGG - Intergenic
925995298 2:9287847-9287869 CTGCATTAGTCATGGAAGGAGGG + Intronic
927176716 2:20415080-20415102 CTGCTCCAGTGGAGGCAGCAGGG + Intergenic
928197593 2:29226661-29226683 ATGTTTAAGTGGAGGCAGGATGG + Intronic
930411472 2:51030973-51030995 GTGCATTAGTGGAGGAGGGCAGG - Intronic
930731817 2:54735082-54735104 CTGCATAAGTGGAGAAAGGAGGG - Intronic
930998249 2:57748892-57748914 CTGCTTTAGTGAAGGGAAGATGG - Intergenic
932028202 2:68157033-68157055 CTGCACTGGGGGTGGCAGGACGG + Intronic
932882854 2:75519816-75519838 TAACATTAGTGGAGACAGGAAGG - Intronic
933355396 2:81203561-81203583 CTGCAGTGGTGGAGGTAGGCTGG + Intergenic
934088007 2:88526222-88526244 CTGGAGTAGAGAAGGCAGGAAGG + Intronic
934991850 2:98927183-98927205 CTGCATTAGTGGAGCCGTGGAGG - Intronic
935889499 2:107660786-107660808 CTCCCTTAGGGGAGGTAGGAAGG + Intergenic
936504913 2:113098477-113098499 TTGCTTTGGTGGAGGCAGCAGGG + Intergenic
936701115 2:115012438-115012460 CTGCTTTGGTGGAGGCAGCAGGG - Intronic
937639658 2:124197221-124197243 CTGCAAAGGTGGAGGAAGGAGGG - Intronic
937913466 2:127087530-127087552 CAGCGTGAGTGGAGGCAGCAGGG + Intronic
938288969 2:130139636-130139658 CTGCTTCAGTGCGGGCAGGATGG + Exonic
938467564 2:131533295-131533317 CTGCTTCAGTGCGGGCAGGATGG - Exonic
938996440 2:136683567-136683589 CTGCTTTGGTGGAGGTAGCAGGG - Intergenic
939364472 2:141214640-141214662 CTGCATTGGTGTGGGTAGGAAGG + Intronic
940423682 2:153508056-153508078 CTGCTCCAGTGGAGGCAGCAGGG + Intergenic
942445096 2:176072272-176072294 CTGCATTTGTGTAGGTAGGAAGG - Intergenic
942994705 2:182246976-182246998 CTTCATGAGTGGAGTAAGGATGG + Intronic
944101970 2:196036749-196036771 CAGCAATAGTGAAGGCAGGTTGG - Intronic
944763613 2:202841787-202841809 ATGCAGGAGTGGAGGCAGGTGGG + Intronic
946340462 2:219063583-219063605 CTCCTTCAGTGGAGGAAGGATGG + Intergenic
946793389 2:223324114-223324136 CAGCCATAGTGGAGCCAGGAGGG - Intergenic
948968045 2:241400097-241400119 CTTCATTAGTGTAGTCAGGCAGG + Intronic
1168818149 20:754991-755013 ATGCATTTGAGGAGGCAGGGTGG - Intergenic
1169202040 20:3715902-3715924 CTGCATTCGGGAAAGCAGGATGG + Intergenic
1170086308 20:12535902-12535924 CTGCTTTGGTGGAGGTAGCAGGG - Intergenic
1171207324 20:23291073-23291095 CTGCCTCTGTGGAGGCAGGGAGG - Intergenic
1171456380 20:25275039-25275061 CTGCTTAAGGGCAGGCAGGAGGG + Intronic
1171514995 20:25723070-25723092 CTAAATTAGGGGAGGAAGGATGG + Intergenic
1172399775 20:34639939-34639961 CTGCAGCAGTGGTAGCAGGAAGG + Intronic
1174089822 20:48037993-48038015 CTGCCTTAGGGGCTGCAGGAGGG - Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1175049993 20:56146423-56146445 CTTCTTCAGTGGTGGCAGGAGGG - Intergenic
1175919331 20:62442672-62442694 CTGCATTTGTGGGGGCCAGAGGG + Intergenic
1183823848 22:40369922-40369944 CAGCTTTAGTGGAAGCACGAGGG + Intronic
1185097762 22:48821049-48821071 CTGCATGTGTGGAGCCAGGATGG - Intronic
950565459 3:13767289-13767311 CGGGATTAGAGGAAGCAGGAGGG - Intergenic
950625498 3:14243790-14243812 CTGCATTGGTGGACACAGGCAGG - Intergenic
950684428 3:14606280-14606302 CTGCAGTAGGGGAGGAATGAAGG + Intergenic
950860405 3:16142830-16142852 CTGCCTCAGTGGAAGCACGAAGG - Intergenic
952082927 3:29782285-29782307 CTGCTTTGGTGGAGGTAGCAGGG - Intronic
955147883 3:56338332-56338354 CTGGATTAGATGAGGCAGGCAGG - Intronic
955335272 3:58080334-58080356 CACCATTACTGGAGGCAGGGAGG + Intronic
959240325 3:103783892-103783914 CTGCATTAGTATAATCAGGAGGG + Intergenic
959387704 3:105732769-105732791 CTGCATGAGTTGAGGAAGGATGG - Intronic
960965424 3:123101051-123101073 CTGGCTGAGTGCAGGCAGGATGG + Intronic
961216558 3:125164739-125164761 CTGCATGAGTAGAGGCTGAAAGG + Intronic
962001692 3:131305060-131305082 ATGCATTTGTGGTGGCAGCATGG + Intronic
962085178 3:132183666-132183688 GTGAATTAGTGGAGGCAAAACGG + Intronic
962309913 3:134318259-134318281 CTGCATTACAGGCGGCAGGATGG - Intergenic
962708487 3:138067054-138067076 CTGGATTTGGGGAGGCTGGAGGG + Intronic
963541798 3:146600377-146600399 CTGGATTGGAAGAGGCAGGAAGG + Exonic
964172160 3:153783623-153783645 CAGTATTAGAGGAGGCAGGGAGG + Intergenic
964393207 3:156218644-156218666 CTGCTTCAGTGGAGGTAGCAGGG - Intronic
965387323 3:168060325-168060347 CTGCAGTAATTGAGGCATGAGGG + Intronic
965404847 3:168255801-168255823 CTCCATTAGGGGAGTCAAGAGGG - Intergenic
968234843 3:197025442-197025464 CTGAAATAGAGCAGGCAGGACGG - Intronic
969015752 4:4103124-4103146 GTGCATGAGGGGATGCAGGATGG + Intergenic
969028808 4:4194959-4194981 CTGCAACAGAGCAGGCAGGAAGG - Intronic
969866213 4:10078566-10078588 CCCCATGAGTGGCGGCAGGAGGG - Intronic
971169532 4:24219107-24219129 CTGAAGTAGTGGTGGCAGAAAGG + Intergenic
972051480 4:34740545-34740567 CTGCATTTGTGTAGGAAGGGTGG + Intergenic
972806515 4:42533776-42533798 CTGCTTTGGTGGAGGTAGCAGGG - Intronic
973675994 4:53263635-53263657 CTGCTCCAGTGGAGGCAGCAGGG + Intronic
973822651 4:54676583-54676605 CTGCATGGGTGGAGGGAGCAGGG + Intronic
974786184 4:66621998-66622020 TTGCATTTGGGGAGGCAGAAAGG + Intergenic
975626684 4:76356864-76356886 CTGCATTAGTATGGGCAGCAAGG + Intronic
975765912 4:77667401-77667423 CTGCAGGAGTGGAGACTGGAAGG - Intergenic
978916143 4:114127821-114127843 CTGCTTTGGTGGAGGCAGCAGGG - Intergenic
979799876 4:124895038-124895060 CTGTATTAGTGGAGGCAAAATGG + Intergenic
980061023 4:128129638-128129660 CTGCAGTAATGAAGGCAGTACGG + Intronic
981004446 4:139860586-139860608 CTGCCTAAGTGGGTGCAGGACGG - Intronic
981238583 4:142447841-142447863 CTACATGAGAGGAGGCAGCAAGG + Intronic
981924742 4:150126695-150126717 CAGCATTACGGGAGGCTGGATGG - Intronic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
982972958 4:162014102-162014124 CTGCATCTGTGGAGGCAAGTGGG + Intronic
983428590 4:167619543-167619565 CTGTATTAGTGGATTCAGGGAGG + Intergenic
984190559 4:176600881-176600903 CTGCTTTGGTGGAGGTAGCAGGG + Intergenic
985385291 4:189439839-189439861 CAGGATTAGTGCAGGCTGGAGGG + Intergenic
985553432 5:544541-544563 CAGCCTGACTGGAGGCAGGAAGG - Intergenic
986018016 5:3775006-3775028 CAGGATCAGTGGAGTCAGGATGG - Intergenic
987846643 5:23295792-23295814 CTGCTTCAGTGGAGGTAGCAGGG + Intergenic
990139107 5:52682579-52682601 CTGCCTTGGTGGGGGAAGGATGG - Intergenic
994146698 5:96403042-96403064 GTGCATGTGTGGAGGCAGGAAGG + Intronic
994597750 5:101860742-101860764 CTCCAGTGGTGGAGGCAGCACGG - Intergenic
996266642 5:121549221-121549243 CTGAATTAGTGGAGGAAAGAAGG - Intergenic
997397650 5:133577263-133577285 CTGCATAACTGGAGGAAGCAGGG - Intronic
997582548 5:135026934-135026956 CTGCAGTGGGGGAGGAAGGAGGG - Intergenic
997735491 5:136209737-136209759 CTTCATTTGCGGAGGCAGGCAGG - Intergenic
998007246 5:138665219-138665241 CTCCATGTGTGGAGGCAGGGAGG + Intronic
998384651 5:141749832-141749854 CAGCATTAGGGGCTGCAGGAAGG - Intergenic
998418213 5:141960493-141960515 GTGCAGTAGTGTAGGGAGGAAGG + Intronic
998981256 5:147705238-147705260 GTGGATTATTGGAGCCAGGAAGG + Intronic
999197084 5:149789689-149789711 CTGCAGTAGTGCAGGCAGCCTGG + Intronic
1002310374 5:178310265-178310287 CCGCAGGAGTGGGGGCAGGACGG + Intronic
1003739660 6:8921613-8921635 CTGGATTAGTCCAGGCAGGGTGG - Intergenic
1005194215 6:23264142-23264164 CTGCTTTAGTGGAGAGATGAGGG + Intergenic
1005902199 6:30226552-30226574 CTGCTTTAGGGAAGGCAGCATGG + Intergenic
1006852098 6:37106042-37106064 CAGCATGGGTAGAGGCAGGAAGG + Intergenic
1006919296 6:37616911-37616933 CAGCATTTCTGGAGGAAGGATGG - Intergenic
1010051099 6:71505264-71505286 CTGCATCAGTGGAGTCACCAGGG + Intergenic
1010500561 6:76594244-76594266 CTGCTCTAGTGAAGGCAGCAGGG - Intergenic
1011942873 6:92864754-92864776 CTGCCTTAGGTGAGACAGGATGG + Intergenic
1012383079 6:98643369-98643391 TTACATTACTGGAGGGAGGAAGG + Intergenic
1012928802 6:105295328-105295350 CAGTAGTAGTGGAGGCAGTAAGG - Intronic
1015899920 6:138053720-138053742 CTGCAGCAGTGGAGGTAGCAGGG - Intergenic
1016216262 6:141607649-141607671 CTGCACTGGTGGAGGTAGCAGGG + Intergenic
1016881109 6:148913099-148913121 CTGGATTAGTGGAGCCAGTAAGG + Intronic
1017056507 6:150441448-150441470 CAGCAGAGGTGGAGGCAGGAAGG - Intergenic
1017548571 6:155479442-155479464 CTGCACTTGTGGAGGGAGGGAGG + Intergenic
1017826761 6:158087258-158087280 CAGCATTAGAGGATGCAGAATGG + Intronic
1018725795 6:166612574-166612596 CAGGATTAGTGGAGGCAGTCGGG - Intronic
1019733388 7:2639163-2639185 CAGCATCCGTGGAGGCAGGTGGG + Intronic
1024927008 7:54627775-54627797 CTGCATTGGGGGAGGCTGCATGG - Intergenic
1026727835 7:72883846-72883868 CTTCATTAGGGGAGGCAAAATGG + Intronic
1027116003 7:75481881-75481903 CTTCATTAGGGGAGGCAAAATGG - Intronic
1028070915 7:86449433-86449455 CTGTATTAGAGAATGCAGGATGG + Intergenic
1028261734 7:88674513-88674535 CTGCTCTGGTGGAGGCAGCAAGG - Intergenic
1029721529 7:102368369-102368391 CTTCATTAGGGGAGGCAAAATGG + Intronic
1031180678 7:118411037-118411059 CTTAATTAGTGGGGGCAGGGAGG + Intergenic
1031655414 7:124349211-124349233 CTGCTATGGTGGAGGCAGCAAGG + Intergenic
1031663011 7:124450610-124450632 CTGACTTAGTGTAGGCATGAAGG - Intergenic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1032552167 7:132794215-132794237 CTGCATTAGTGGATGATGGATGG + Intronic
1033348615 7:140544195-140544217 CTTTATTTGTGGGGGCAGGAGGG + Intronic
1033494063 7:141876500-141876522 CTACAGTGGTGGAGGCAGCAGGG + Intergenic
1033735972 7:144222224-144222246 CTGAATATGTGAAGGCAGGAGGG + Intergenic
1033747079 7:144328728-144328750 CTGAATATGTGAAGGCAGGAGGG - Intergenic
1034255028 7:149720223-149720245 TTGCAGTAGGGGAGGCAGGGAGG - Intronic
1034257701 7:149733568-149733590 CTGCCCTACTGGAGGCAGAAGGG + Exonic
1035095662 7:156352735-156352757 CTGTACTAGATGAGGCAGGATGG - Intergenic
1035225034 7:157428156-157428178 CTGCAGTTGAGGAGGGAGGAGGG + Intergenic
1037405358 8:18536871-18536893 CTTCATGCGTTGAGGCAGGATGG - Intronic
1037852799 8:22346406-22346428 CAGCATCAGAGGAGGAAGGATGG - Intronic
1039439101 8:37582263-37582285 CTGCATTTTTGGATGCAGGCAGG - Intergenic
1041438352 8:57866659-57866681 CTGCATCAGGGGTGGCAGCAGGG + Intergenic
1041974795 8:63785209-63785231 CTGCATTTGGTGAGGCAGGAGGG + Intergenic
1042645482 8:70982027-70982049 CTGCACTGGTGGAGGTAGCAGGG + Intergenic
1042733936 8:71966846-71966868 CTGTAATAGTCCAGGCAGGAAGG - Intronic
1044788187 8:95818751-95818773 CTGCTCTAGTGGAGGTAGCAGGG + Intergenic
1046615320 8:116471160-116471182 GTGCATTAGCTGAGGCAGGGAGG + Intergenic
1046766298 8:118073928-118073950 CTTCATTAGAGAAGGGAGGAGGG + Intronic
1048222443 8:132554143-132554165 CTGCACTCGTGGAGGCTGGAGGG + Intergenic
1048846956 8:138611181-138611203 CTCCATTTCTGGAGGCAAGAGGG - Intronic
1049403965 8:142443401-142443423 CTGCAGCACTGGAGGCAGGTGGG + Intergenic
1050044603 9:1529747-1529769 CTGCAATAGTAAAGGCAGGTGGG + Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051885613 9:21889779-21889801 CTGCTTCAGTGGAGGTAGCAGGG + Intronic
1054961978 9:70979408-70979430 CTGCATTAGAGGAGGCAGAGGGG + Intronic
1055027362 9:71736353-71736375 CTGCATCAGTGAAGGTAGCAGGG + Intronic
1055067578 9:72134077-72134099 GTGAATTAGTGGAGGGAGTAGGG + Intronic
1056280029 9:85032137-85032159 ATAGAATAGTGGAGGCAGGAAGG - Intergenic
1056756687 9:89386170-89386192 CTGAATTGGGGAAGGCAGGAAGG - Intronic
1056935298 9:90911534-90911556 CTGCAACAGTGGAGGCTGGGGGG + Intergenic
1056948119 9:91018067-91018089 CTGCTCTGGTGGAGGCAGCAGGG - Intergenic
1058011712 9:99985171-99985193 CTGCAATAGTTGTGGTAGGATGG - Intronic
1058843375 9:108932840-108932862 TTGAATCAGTGGAGGCAGGAAGG - Intronic
1062034141 9:134375358-134375380 CTGCAATTCTGGAGGCAGGAAGG - Intronic
1062480314 9:136747998-136748020 CTGCAGAACTGGAGGCTGGAGGG - Intronic
1185612892 X:1402785-1402807 CTGCATTTGGGGAGGGGGGAAGG - Intergenic
1187123427 X:16431044-16431066 CTGCATTAGTGTATTCATGATGG - Intergenic
1189567254 X:42255402-42255424 CTGCTTCAGTGGAGGCAGCAGGG - Intergenic
1191738906 X:64416824-64416846 CTGCATAGGTGGTGGCAGAAAGG + Intergenic
1191823687 X:65340271-65340293 CAGCAGTAGTGGAGGCAGCATGG - Intergenic
1192569343 X:72190041-72190063 CAGGATTGGCGGAGGCAGGAAGG - Intronic
1194470195 X:94284967-94284989 CTGCTCTGGTGGAGGTAGGAGGG + Intergenic
1195474118 X:105264592-105264614 GCGTATTAGTGGAGGCAGGATGG + Intronic
1196949054 X:120857635-120857657 CTGCTCCAGTGGAGGCAGCAGGG - Intergenic
1199361904 X:146930186-146930208 CAGCATTTGTGGAAGAAGGAGGG + Intergenic
1199424256 X:147682411-147682433 CTGCTTTGGTGGAGGCAGCAGGG - Intergenic
1199859082 X:151783538-151783560 CTGCTTCTGTGCAGGCAGGATGG + Intergenic