ID: 907905248

View in Genome Browser
Species Human (GRCh38)
Location 1:58778561-58778583
Sequence CTGCATTAGTGGAGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907905242_907905248 3 Left 907905242 1:58778535-58778557 CCCATTTAATGTAAGAAGATGCT No data
Right 907905248 1:58778561-58778583 CTGCATTAGTGGAGGCAGGAAGG No data
907905243_907905248 2 Left 907905243 1:58778536-58778558 CCATTTAATGTAAGAAGATGCTC No data
Right 907905248 1:58778561-58778583 CTGCATTAGTGGAGGCAGGAAGG No data
907905241_907905248 29 Left 907905241 1:58778509-58778531 CCTTCAAAACTAATGTTTCAGGC No data
Right 907905248 1:58778561-58778583 CTGCATTAGTGGAGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907905248 Original CRISPR CTGCATTAGTGGAGGCAGGA AGG Intergenic
No off target data available for this crispr