ID: 907908661

View in Genome Browser
Species Human (GRCh38)
Location 1:58808343-58808365
Sequence TAGGAGAGCCACTCCAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907908661_907908667 15 Left 907908661 1:58808343-58808365 CCACATCTGGAGTGGCTCTCCTA No data
Right 907908667 1:58808381-58808403 CTACTCTTCCTGCTCATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907908661 Original CRISPR TAGGAGAGCCACTCCAGATG TGG (reversed) Intergenic
No off target data available for this crispr