ID: 907908662

View in Genome Browser
Species Human (GRCh38)
Location 1:58808362-58808384
Sequence GTAGGGACAGAGAAGGGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907908662_907908669 14 Left 907908662 1:58808362-58808384 CCTATACCCTTCTCTGTCCCTAC No data
Right 907908669 1:58808399-58808421 GCTGGCCATCTTACCCAACCAGG No data
907908662_907908667 -4 Left 907908662 1:58808362-58808384 CCTATACCCTTCTCTGTCCCTAC No data
Right 907908667 1:58808381-58808403 CTACTCTTCCTGCTCATTGCTGG No data
907908662_907908675 29 Left 907908662 1:58808362-58808384 CCTATACCCTTCTCTGTCCCTAC No data
Right 907908675 1:58808414-58808436 CAACCAGGCCCAAAGAGGCAGGG No data
907908662_907908674 28 Left 907908662 1:58808362-58808384 CCTATACCCTTCTCTGTCCCTAC No data
Right 907908674 1:58808413-58808435 CCAACCAGGCCCAAAGAGGCAGG No data
907908662_907908671 24 Left 907908662 1:58808362-58808384 CCTATACCCTTCTCTGTCCCTAC No data
Right 907908671 1:58808409-58808431 TTACCCAACCAGGCCCAAAGAGG No data
907908662_907908676 30 Left 907908662 1:58808362-58808384 CCTATACCCTTCTCTGTCCCTAC No data
Right 907908676 1:58808415-58808437 AACCAGGCCCAAAGAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907908662 Original CRISPR GTAGGGACAGAGAAGGGTAT AGG (reversed) Intergenic
No off target data available for this crispr