ID: 907908663

View in Genome Browser
Species Human (GRCh38)
Location 1:58808368-58808390
Sequence GGAAGAGTAGGGACAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907908663_907908667 -10 Left 907908663 1:58808368-58808390 CCCTTCTCTGTCCCTACTCTTCC No data
Right 907908667 1:58808381-58808403 CTACTCTTCCTGCTCATTGCTGG No data
907908663_907908671 18 Left 907908663 1:58808368-58808390 CCCTTCTCTGTCCCTACTCTTCC No data
Right 907908671 1:58808409-58808431 TTACCCAACCAGGCCCAAAGAGG No data
907908663_907908674 22 Left 907908663 1:58808368-58808390 CCCTTCTCTGTCCCTACTCTTCC No data
Right 907908674 1:58808413-58808435 CCAACCAGGCCCAAAGAGGCAGG No data
907908663_907908669 8 Left 907908663 1:58808368-58808390 CCCTTCTCTGTCCCTACTCTTCC No data
Right 907908669 1:58808399-58808421 GCTGGCCATCTTACCCAACCAGG No data
907908663_907908678 28 Left 907908663 1:58808368-58808390 CCCTTCTCTGTCCCTACTCTTCC No data
Right 907908678 1:58808419-58808441 AGGCCCAAAGAGGCAGGGGAAGG No data
907908663_907908675 23 Left 907908663 1:58808368-58808390 CCCTTCTCTGTCCCTACTCTTCC No data
Right 907908675 1:58808414-58808436 CAACCAGGCCCAAAGAGGCAGGG No data
907908663_907908676 24 Left 907908663 1:58808368-58808390 CCCTTCTCTGTCCCTACTCTTCC No data
Right 907908676 1:58808415-58808437 AACCAGGCCCAAAGAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907908663 Original CRISPR GGAAGAGTAGGGACAGAGAA GGG (reversed) Intergenic
No off target data available for this crispr