ID: 907908667

View in Genome Browser
Species Human (GRCh38)
Location 1:58808381-58808403
Sequence CTACTCTTCCTGCTCATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907908661_907908667 15 Left 907908661 1:58808343-58808365 CCACATCTGGAGTGGCTCTCCTA No data
Right 907908667 1:58808381-58808403 CTACTCTTCCTGCTCATTGCTGG No data
907908663_907908667 -10 Left 907908663 1:58808368-58808390 CCCTTCTCTGTCCCTACTCTTCC No data
Right 907908667 1:58808381-58808403 CTACTCTTCCTGCTCATTGCTGG No data
907908662_907908667 -4 Left 907908662 1:58808362-58808384 CCTATACCCTTCTCTGTCCCTAC No data
Right 907908667 1:58808381-58808403 CTACTCTTCCTGCTCATTGCTGG No data
907908660_907908667 19 Left 907908660 1:58808339-58808361 CCAGCCACATCTGGAGTGGCTCT No data
Right 907908667 1:58808381-58808403 CTACTCTTCCTGCTCATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907908667 Original CRISPR CTACTCTTCCTGCTCATTGC TGG Intergenic
No off target data available for this crispr