ID: 907909252

View in Genome Browser
Species Human (GRCh38)
Location 1:58812875-58812897
Sequence CAGGGAAAAGAGGAGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1282
Summary {0: 1, 1: 1, 2: 9, 3: 111, 4: 1160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907909252_907909255 -9 Left 907909252 1:58812875-58812897 CCATCATCCTCCTCTTTTCCCTG 0: 1
1: 1
2: 9
3: 111
4: 1160
Right 907909255 1:58812889-58812911 TTTTCCCTGTCCACATAACATGG 0: 1
1: 0
2: 4
3: 17
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907909252 Original CRISPR CAGGGAAAAGAGGAGGATGA TGG (reversed) Intergenic
900166094 1:1244908-1244930 GAGGGGGAAGAGGAGGAGGAGGG - Intronic
900297968 1:1961783-1961805 CAGGGAAGAGAGGAAGGAGACGG + Intronic
900474557 1:2869996-2870018 CAGAGGGAAGAGGAGGATGAAGG + Intergenic
900495013 1:2972337-2972359 CAGGGCTGAGGGGAGGATGAAGG - Intergenic
900803490 1:4752159-4752181 GAGGGAGGAGAGGAGGAGGAGGG + Intronic
900912945 1:5615023-5615045 CAGGGAATATAGCAGGATGAAGG + Intergenic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901813797 1:11782446-11782468 CTGGGAAAAAAGGGGCATGAAGG + Intronic
902050749 1:13562072-13562094 GAGGGAAAGGAGGAGGATTTGGG - Intergenic
902130153 1:14253186-14253208 CAGGAAGAAGAGGAGGACCATGG + Intergenic
902205800 1:14867225-14867247 AAGGCAAAAGAGGAGGGAGAGGG - Intronic
902730381 1:18365076-18365098 AAGGGAAAAGAGTGGGGTGAGGG + Intronic
902976626 1:20093212-20093234 GAGGAAGAAGAGGAGGAGGAAGG - Intergenic
902977553 1:20099880-20099902 AAGACAAAAGAGAAGGATGAGGG - Intergenic
903337297 1:22633657-22633679 GGAGGAAAAGAGGAGGAGGAGGG - Intergenic
903378993 1:22884004-22884026 CAGAGATGAGGGGAGGATGAGGG - Intronic
903395294 1:22997435-22997457 AAGAGAAAATAGGAGGAAGAAGG - Intergenic
903619594 1:24688330-24688352 GAGGAAACAGAGGAGGCTGAGGG - Intergenic
904011091 1:27391159-27391181 CAGGGAACATGGGAGGAGGAGGG - Intergenic
904357151 1:29947734-29947756 CAAGGAAAAGAAGAGGAGGAAGG - Intergenic
904439255 1:30519205-30519227 GATGGAAAAGATGAGGAGGATGG + Intergenic
904724369 1:32535764-32535786 GAGGAATAAGTGGAGGATGAAGG - Intronic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
904955875 1:34283465-34283487 CAGGGACCTGAGGAAGATGAGGG - Intergenic
905310108 1:37043157-37043179 CAGGGAAGAGAGGAGCATGAAGG + Intergenic
905313071 1:37064085-37064107 CAGGGAAGAGAGGAGCAGAAGGG + Intergenic
905442004 1:38001593-38001615 CAGGGAAAAGGGCAGGGAGAGGG - Intronic
905543062 1:38775467-38775489 TAGGGTAAAGAAGAGGAGGAAGG - Intergenic
905697968 1:39989809-39989831 CTGGGAGAAGAGAAGGATGGGGG - Intergenic
905835816 1:41119841-41119863 GAGGGAAAAAAGGAGGAGGCAGG - Intronic
906180881 1:43817743-43817765 GAGGAAGAAGAGGAGGAAGAAGG - Intronic
906436651 1:45802425-45802447 CAGGGAATAGAGGAGCAGGCTGG + Intronic
906661480 1:47585921-47585943 CAGCCAGAAGAGGAGGAAGAGGG + Intergenic
907279115 1:53333943-53333965 CAGAGGAAAGGAGAGGATGAAGG + Intergenic
907489138 1:54797928-54797950 CCAGGAAAGGAGGAGGAGGAGGG - Intronic
907745177 1:57206225-57206247 CAGGGAGAAAAGGAGGGAGAGGG + Intronic
907803734 1:57797311-57797333 CAGGGTAAAGGGGAGAATCAAGG + Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
908533502 1:65055956-65055978 CGGGGAAAACAGGAAGATCAGGG + Intergenic
908805074 1:67922117-67922139 CAGGGAAACCAAGAGGTTGATGG + Intergenic
909500439 1:76329295-76329317 CATTGAAAAGAGGAGGCTCATGG - Intronic
909686539 1:78355188-78355210 GAGGGAGAAGAGGAGGAAGAGGG - Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910700293 1:90066730-90066752 CTAGGAAAAGACGGGGATGAGGG + Intergenic
910772959 1:90848188-90848210 CAAGGAAAAGAGTGGGATGGGGG - Intergenic
910849693 1:91637962-91637984 GAGGGATATGAGGAGGTTGAGGG + Intergenic
910896409 1:92074546-92074568 GAGGAAGGAGAGGAGGATGAAGG - Exonic
911031741 1:93496243-93496265 AAGGAAAAAGAGGAGAAGGAAGG - Intronic
911153572 1:94618461-94618483 CATGGAAAAGGGTGGGATGAAGG - Intergenic
911634772 1:100222744-100222766 CAGTGAAAGGAGGAGAAAGAGGG - Intronic
912157375 1:106938434-106938456 ATGGGAAAAGAGAAGGATGCTGG - Intergenic
912333485 1:108841410-108841432 CAGGGAGAAGTGGCTGATGAAGG + Intronic
912385122 1:109267654-109267676 CAGGGAAAAGATGGAGATGAGGG - Intronic
912393696 1:109322946-109322968 CAGGGAACAGAGGCAGATGGAGG + Exonic
912450941 1:109767370-109767392 CAGGGTGAACAGGATGATGATGG - Intronic
912491412 1:110064766-110064788 CCGGGGAAAGAGGAAGATGCAGG + Exonic
912560102 1:110545006-110545028 AAGGGAAAAGAGGAAGAAGGGGG - Intergenic
912700892 1:111877532-111877554 CAGGGAAGAGAGGAGTGTGGAGG + Intronic
912710867 1:111948798-111948820 CAGGGAAGTGGGGAAGATGAGGG + Intronic
912744977 1:112238644-112238666 GAAGGAAATGAGGAGGAAGATGG - Intergenic
912745676 1:112243629-112243651 AAGAGAAAAGAAGAGCATGAAGG + Intergenic
912804009 1:112741785-112741807 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913197194 1:116467076-116467098 GAGGAAGAAGAGGAAGATGATGG + Intergenic
913319943 1:117581185-117581207 CAGGGAAGACTGGAGAATGAAGG + Intergenic
913338505 1:117733314-117733336 CAGGGACGAGAGGAGCAGGAGGG - Intergenic
913356925 1:117932129-117932151 AAGGGACAAGAGGTGAATGAAGG - Intronic
913387554 1:118276083-118276105 CAGGGAAAGGAGGAGACAGAAGG + Intergenic
913423500 1:118699940-118699962 GAGGAAAAAGAGGAGTAGGAGGG - Intergenic
913441496 1:118903072-118903094 CAGGGAAAAAATGAGCAAGAGGG - Intronic
913675945 1:121140224-121140246 GAGCCAAAAGAGGAGGATGTAGG + Intergenic
914027841 1:143928164-143928186 GAGTCAAAAGAGGAGGATGTAGG + Intergenic
915223956 1:154397879-154397901 CAGGGAGAAGAGGAAGAAGGTGG - Intergenic
915273417 1:154771909-154771931 CAGGGAAGGGAGGAGGAGTAGGG - Intronic
915280417 1:154818604-154818626 CAGGGAAGGCAGGAGGCTGAGGG - Intronic
915444938 1:155969276-155969298 CCGGGAAAAGGAGAAGATGAAGG - Exonic
915498057 1:156295067-156295089 CAGGCAAAAGAGAAGCTTGAGGG + Intronic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916006947 1:160670949-160670971 GAGGAAGGAGAGGAGGATGAAGG + Intergenic
916242911 1:162657790-162657812 AAGGGAAAAGAGGAAGGAGAGGG - Intronic
916475184 1:165162335-165162357 TAGGGCAAAGAGGAGTAGGAAGG + Intergenic
916702377 1:167311025-167311047 CTGGGAAGAGAGGAGAAAGAGGG + Intronic
916881625 1:169024553-169024575 GAAGGAGAAGAGGAGGAGGAAGG + Intergenic
916881630 1:169024575-169024597 GAAGGAGAAGAGGAGGAGGAAGG + Intergenic
916881638 1:169024610-169024632 GAAGGAGAAGAGGAGGAGGAAGG + Intergenic
916918162 1:169432925-169432947 CAGGTATAAGATGAGGATGCTGG + Intronic
916988062 1:170213038-170213060 AAGGGAAAGGAGGAGTAAGATGG - Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
918002924 1:180514566-180514588 GAGGAAGAAGAGGAGGAGGAGGG + Intergenic
918100160 1:181365883-181365905 TAGGGTAGAGAGGAGGATTAGGG + Intergenic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919091045 1:192979301-192979323 GAGGGAAAGGAGGAGGATTTGGG + Intergenic
919239941 1:194901279-194901301 AAAGCAAAAGAGGAGGGTGAGGG + Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919728576 1:200899151-200899173 GAAGGAAAAGAGGAAGAAGAAGG + Intronic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920260083 1:204683447-204683469 AAGGAAGGAGAGGAGGATGAGGG + Intronic
920286778 1:204885366-204885388 CAGGGCAAAGGGGAGGGTGAAGG - Intronic
920346365 1:205308266-205308288 CAGGGAAGGGAAGATGATGAGGG + Intronic
920420150 1:205827696-205827718 CAAGGGAAAGTGGAGGAGGAGGG - Intergenic
920441624 1:205984750-205984772 CAGGGAAAAAAGGAGAAAGCAGG - Intronic
920463315 1:206159061-206159083 GAGCCAAAAGAGGAGGATGTAGG + Intergenic
920688427 1:208127650-208127672 TAGGGAGTAGAAGAGGATGAAGG + Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920844332 1:209581118-209581140 CAGGCACAGGAGGAGGATGGAGG + Intergenic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
920966128 1:210702386-210702408 AAGGAAAAAGGGGAGGAGGAAGG - Intronic
920972210 1:210752645-210752667 TAGGGAACAGAGGATGAGGAGGG + Intronic
921102628 1:211943597-211943619 AGAGGAAAAGAGGAGAATGAAGG + Intronic
921193339 1:212729262-212729284 GAGGGAAAAGAGGGAGCTGAGGG - Intronic
921219616 1:212963962-212963984 GAGGTAAAAGAGGAAAATGAAGG - Intronic
921334919 1:214076332-214076354 CTGGGAAAGGAAGAGGAAGAAGG + Intergenic
921382551 1:214539709-214539731 GAGGGAAGAGAGGAGGAGGGAGG + Intronic
921488122 1:215740195-215740217 CAGGCAAAGGAAGAGAATGAGGG - Intronic
921742158 1:218697634-218697656 CAGGTTAAAGAGGAGGATTGAGG - Intergenic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
922152888 1:223020533-223020555 GAGGGAAAAGAGGATGCTGGTGG - Intergenic
922187975 1:223293206-223293228 TAGGGGTAAGAGGAGGAGGAAGG - Intronic
922190552 1:223314975-223314997 GATGGGAAAGAGGAGGCTGAGGG + Intronic
922240593 1:223753102-223753124 CAGGGAAAAGAAAAGGCTCAGGG - Intronic
922247748 1:223817247-223817269 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247756 1:223817265-223817287 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247764 1:223817283-223817305 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247772 1:223817301-223817323 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247780 1:223817319-223817341 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247788 1:223817337-223817359 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247796 1:223817355-223817377 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247804 1:223817373-223817395 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922412728 1:225391712-225391734 CAGGGAGAGGAGCAGGCTGATGG + Intronic
922601242 1:226856127-226856149 AAGAGAAAATAGGAGGAGGAAGG - Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922924489 1:229336437-229336459 CTGGGAACAGAGGTGGAGGAAGG - Intronic
923216185 1:231850175-231850197 CAAGGAACAGAGGAGGGTGGAGG + Intronic
924110319 1:240692373-240692395 CTGGGTAAAGAGGAGGCTGCCGG - Intergenic
924481153 1:244435536-244435558 GAGGTAGAGGAGGAGGATGAAGG - Intronic
924481167 1:244435615-244435637 GAGGTAGAGGAGGAGGATGAAGG - Intronic
924802889 1:247340469-247340491 CAGCTAATAGAGGAGGAAGAAGG - Intergenic
924952193 1:248895372-248895394 AAGGACAAAGAGGAGGAAGAAGG + Intergenic
1062898667 10:1125051-1125073 CAGGGCACAGTGGAGGAGGACGG + Intronic
1063598326 10:7457670-7457692 CAGGGAAAAGAGGTTGTGGAAGG - Intergenic
1063872088 10:10428658-10428680 CAAGGAAAAGAGTGGGAAGAGGG - Intergenic
1063913470 10:10855636-10855658 AACAGAAAAGAGGAGGATCAGGG + Intergenic
1064216812 10:13407278-13407300 AAGGGAAAGGAGGAAGATGCCGG + Intergenic
1064287325 10:14003186-14003208 CACGGAATAGAGGAGCAGGACGG + Intronic
1065227918 10:23565190-23565212 CATATAAAAAAGGAGGATGAAGG - Intergenic
1065268772 10:24004966-24004988 CAAGGAAAAGAGATGGATGGTGG + Intronic
1065305784 10:24367239-24367261 GAGGGAAAGGTGCAGGATGAGGG - Intronic
1065610420 10:27466645-27466667 GAGGGAAAGGAGGAGGATTTGGG - Intergenic
1065694287 10:28365661-28365683 AAGTGAAAAAAGGAGGAAGAAGG + Intergenic
1066111427 10:32200531-32200553 CAGAGAAGAGGGGAGGATGAGGG + Intergenic
1066214399 10:33272497-33272519 GAGGAGAAAGAGGAGGAGGAGGG + Intronic
1066425980 10:35308243-35308265 CACGCAAAAGAGGAGGAGGTGGG + Intronic
1066466008 10:35650903-35650925 TGGGGAAAAGAGGAGGAGAAAGG - Intergenic
1066626819 10:37415527-37415549 GAGGGAAAGGAGGAGAAGGAGGG + Intergenic
1067065739 10:43103119-43103141 CAGGGAAGAGCTGAGGCTGATGG + Intronic
1067165708 10:43864861-43864883 CAGGGAAGTGAGGAGGGTGGGGG + Intergenic
1067517128 10:46960336-46960358 CAGAGAAAAAAGGTAGATGAGGG - Intronic
1067645121 10:48091493-48091515 CAGAGAAAAAAGGTAGATGAGGG + Intergenic
1067702531 10:48584015-48584037 CTGGGGACAGAGGAGAATGAAGG - Intronic
1068774747 10:60857499-60857521 CAGGGAAAGGGGGAGATTGAGGG + Intergenic
1068874790 10:61984580-61984602 GAGTGAAAGGAGGAAGATGAAGG + Intronic
1069060968 10:63894139-63894161 AAGGAAAGAGAGGAGGAGGAAGG - Intergenic
1069920388 10:71812386-71812408 CAGGGAAATGGGCAGGATGTGGG + Intronic
1069994184 10:72332517-72332539 GAGGGAAAAGCAGAGGGTGATGG + Intergenic
1070171695 10:73937855-73937877 CTGGGGAAGGAGGAGGATGTTGG + Intergenic
1070367996 10:75754725-75754747 CGGGGAAAAGGGGAGAAAGAAGG - Intronic
1070476810 10:76836841-76836863 GAGGGCAAAGAGGATGAGGAAGG - Intergenic
1071203798 10:83251655-83251677 GAGAGAAAAGAGGAAGAAGAAGG + Intergenic
1071333934 10:84586555-84586577 CAAGGATAAGAGGAGAAGGAGGG - Intergenic
1071388925 10:85150379-85150401 TAGGAAAAAGAGGAGGAGGAAGG - Intergenic
1071441609 10:85702880-85702902 GAAGGAAAAGAGGAGGAAGACGG + Intronic
1071778094 10:88811577-88811599 TAGAGAATAGAGAAGGATGAAGG - Intronic
1071877793 10:89861436-89861458 GAGGGGGAAGAGGAGGAGGAGGG - Intergenic
1072050207 10:91696550-91696572 AAGGGAAGAGAGAGGGATGATGG + Intergenic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072255167 10:93614143-93614165 AAGGGAAAAGTGGATTATGATGG + Intronic
1072411955 10:95210991-95211013 GAGGGAAAAGAGGAAGAGCAGGG + Intronic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072443361 10:95477123-95477145 AAGGGAAAAGAGGAGGAGGTCGG - Intronic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1072613890 10:97036990-97037012 CCAGGAAAAGTGGAGGGTGATGG - Intronic
1073144211 10:101269304-101269326 CAGGGATGAGAGTAGGATGGTGG + Intergenic
1073146703 10:101285976-101285998 CAAGGGAAAGAGGAGGCAGAGGG - Intergenic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073359659 10:102887849-102887871 CTGGAAAAAGAAGAGGAGGAAGG - Intronic
1073511896 10:104047719-104047741 CAGGTAACAGAGCAGGAAGAGGG - Exonic
1073920044 10:108448382-108448404 GATGGAAAAGAGGAAGAGGAGGG + Intergenic
1073955633 10:108868266-108868288 GAGAAAGAAGAGGAGGATGAAGG + Intergenic
1074026089 10:109637087-109637109 AAGAGAAAATAGGGGGATGAAGG - Intergenic
1074364972 10:112850428-112850450 AAGGGTAAAGAAGAGGGTGAGGG + Intergenic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074577576 10:114684829-114684851 AAGGAAAAAGAGGAGGCAGAAGG - Intronic
1074614545 10:115054103-115054125 GAGGGCAAAGAGGAAGAGGAGGG - Intergenic
1074722511 10:116274483-116274505 CGGGGAGAAGAAGAGGAGGAAGG + Intergenic
1075125571 10:119696474-119696496 AAAGGAAAGGAGAAGGATGATGG - Intergenic
1076318900 10:129564261-129564283 GAGGGGGAAGAGGAGGAGGAAGG - Intronic
1076457556 10:130611280-130611302 CAGGGAGAAGAAGAGGAGGGAGG + Intergenic
1076567367 10:131407910-131407932 GAGGGAGAAAAGGAGGATGCAGG - Intergenic
1077010468 11:377047-377069 GAGGGCGAAGAGGAGGAGGAAGG + Exonic
1077023202 11:428728-428750 CAGGGTCAGGACGAGGATGACGG + Exonic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077159991 11:1108314-1108336 GAGGGAAAAGGGCAGGCTGAAGG - Intergenic
1077640622 11:3878194-3878216 AAGGGAAAGGAGGAGGGTTAAGG + Intronic
1077700258 11:4434828-4434850 CAGGGGAATGAGGGGCATGAAGG - Intergenic
1077840430 11:5968375-5968397 CAGGAGGAAGAGGAGGCTGAGGG + Exonic
1078155647 11:8797744-8797766 CAGGAAAAAGAGTAGGGTGCTGG - Intronic
1078349018 11:10577264-10577286 AAGGAAGAAGAGGAGGAAGAGGG - Intronic
1079005461 11:16788746-16788768 CAGAGAGGAGAGGAGGAAGATGG - Exonic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079331297 11:19535193-19535215 CAGGGAAAACAGGAAGCTGCTGG + Intronic
1079400757 11:20104587-20104609 AGGGGGAAAGAGGAGGACGATGG - Intronic
1079585250 11:22118301-22118323 CATGGAACATAGGAGAATGAAGG - Intergenic
1080117995 11:28641881-28641903 CTGGGAAAAGGGGAGGCTGTGGG + Intergenic
1080159778 11:29159912-29159934 AAGAGAAAAGAGGAGGAGGATGG + Intergenic
1080484066 11:32686118-32686140 CAGATGAAAGAGGATGATGAAGG + Intronic
1080603218 11:33841331-33841353 AAGGGAAAGGAGGAGGGAGAAGG - Intergenic
1081390071 11:42518784-42518806 CAGGGAAAACAGGCAGGTGAAGG + Intergenic
1081460002 11:43263791-43263813 CAGGGAGAAGCTGAGGAGGATGG - Intergenic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081643555 11:44774622-44774644 GAGGGAAGAAGGGAGGATGAAGG - Intronic
1082110113 11:48264801-48264823 TAGGGAAAATAGGAGGAGTAAGG + Intergenic
1082717676 11:56634947-56634969 GAGGGAGAAGAGGAGGAACAAGG - Intergenic
1082812880 11:57489221-57489243 CAGGGAGAGGGGAAGGATGAAGG + Intronic
1083333761 11:61911367-61911389 CCTGGAAATGAGGAGGAAGAGGG - Intronic
1083384600 11:62298259-62298281 CAGTGATAAGAGGAGGCTCAAGG + Intronic
1083614961 11:64021701-64021723 CAAGGGGAAGAGGAGAATGAAGG - Intronic
1083884634 11:65566418-65566440 GAGGGAAAGGAGGAGGGGGAGGG - Intergenic
1084476082 11:69390565-69390587 GAGGGAGAGGAGGAGGAGGAGGG + Intergenic
1084529267 11:69717478-69717500 GAGGGAGGAGAGGAGGATGGAGG - Intergenic
1084623935 11:70293803-70293825 CAGGGTAAAGCAGAGGCTGAGGG - Intronic
1085034617 11:73292606-73292628 CAGGGGAAAGAGGGGGATGGGGG - Intronic
1085134421 11:74073022-74073044 CAGGCAAAAGAGAAGGGTGACGG + Intronic
1085658284 11:78337533-78337555 CAGGGAAAAGAGAAAGAAGGTGG + Intronic
1086089695 11:82993154-82993176 CAAGGAAAGGAGGAAGGTGATGG - Intronic
1086532690 11:87804329-87804351 CAGAGAACAGAGGACAATGATGG - Intergenic
1086909547 11:92456915-92456937 CTGGGTAAAGAGGATGATCATGG + Intronic
1087207734 11:95414989-95415011 AAAGAAGAAGAGGAGGATGAGGG + Intergenic
1087352363 11:97048123-97048145 AAGAAAAAAGAGGAGGGTGATGG - Intergenic
1087498734 11:98923655-98923677 GAGGGAAAGGAAGAGGAAGAAGG - Intergenic
1087500657 11:98949248-98949270 CCTGGAAAACAGGAGGGTGAAGG - Intergenic
1087666361 11:101053624-101053646 GAGGGAAGAAAGGAGGAAGAAGG - Intronic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1088238343 11:107749034-107749056 GAGGGAAATTAGGAGGATGAAGG + Intergenic
1088697388 11:112380071-112380093 CACGGAAGAGAGGAGTATGGAGG + Intergenic
1089273010 11:117314935-117314957 GAGGGAGAAGGGGAGGAGGAGGG + Intronic
1089303444 11:117512452-117512474 CAGGGAAAAAATGGGGATGAGGG + Intronic
1089569241 11:119392137-119392159 CAGGGAAAAGGGTGGGAGGAAGG - Intergenic
1089867168 11:121642110-121642132 GAGGGAAAGGAGGAGGATCTGGG + Intergenic
1090132533 11:124159705-124159727 GAGGGAAATGAAGAGGAGGAGGG - Intergenic
1090353460 11:126122888-126122910 CAAGCAGAAGAGGAGGCTGAGGG + Intergenic
1090529377 11:127574839-127574861 CAGGGAAAAGACCAGAAAGACGG + Intergenic
1090716814 11:129438442-129438464 CAGGCAAAAGAAGAGGAAGAAGG - Intronic
1090725713 11:129525645-129525667 GAGGGGAAAGAGGAGGCTGGGGG + Intergenic
1090806083 11:130203179-130203201 CAGGGCAAAGAGCTGGATGGGGG + Intronic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1092041241 12:5386542-5386564 GAGGAAAAGGAGGAGGATGAAGG - Intergenic
1092120544 12:6040713-6040735 CATGGGAATGAGGAGGATGGGGG - Intronic
1092228527 12:6764443-6764465 CAGGAAAAATAGGAGGAAGGTGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1093125252 12:15321712-15321734 CAGGCAGAGGAGGAGGAAGAGGG + Intronic
1093148056 12:15590184-15590206 TCGGGAGAAGAGGAGGAAGACGG - Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093709884 12:22318549-22318571 CAGGGAAAAGAGGGGGAAGGAGG - Intronic
1094321599 12:29189988-29190010 GAGGGGAAATAGAAGGATGAAGG + Intronic
1094339637 12:29396506-29396528 CAGGGAGAAGAGGAAGGTCAAGG - Intergenic
1094470602 12:30797718-30797740 CAAGGAAATGAAGATGATGATGG - Intergenic
1094533544 12:31300349-31300371 CAGGCAAAAGAGTGGGATGGGGG + Intronic
1095281538 12:40357067-40357089 GTGGGAGAAGGGGAGGATGAAGG - Intronic
1095309988 12:40687413-40687435 GAGGGAAAAAAGGAGGGTGAGGG - Intergenic
1095534999 12:43234842-43234864 AAGTGAAAAGAAGAGGATCAAGG + Intergenic
1095667672 12:44820961-44820983 CAGGAATGAGAGGAGGATGGAGG + Intronic
1096024113 12:48346539-48346561 TATGGAAAAGAAGAGGAAGAAGG - Intronic
1096183234 12:49562516-49562538 GTGGGAAAAGAAGAGGAAGAAGG + Intronic
1096420275 12:51451060-51451082 CAGGGGAATGGGGAGGCTGAGGG + Intronic
1096587976 12:52636127-52636149 CAGGGGAAAGAAGAGAAGGAGGG - Intergenic
1096609691 12:52792807-52792829 CTGAGAAAAGAGGAAGATAAAGG + Intronic
1096618536 12:52848205-52848227 CAGGGGAAAGGTGAGGCTGATGG - Intronic
1096622963 12:52875849-52875871 CACCAAAAAGAGGATGATGAGGG + Intergenic
1096756524 12:53804185-53804207 CAGGAAGAAGAGGTTGATGATGG + Intergenic
1097007746 12:55931342-55931364 CAGGTAAAGTGGGAGGATGAGGG + Exonic
1097397850 12:59097769-59097791 AAGGGAGAGAAGGAGGATGAAGG + Intergenic
1097477653 12:60078608-60078630 GATAGGAAAGAGGAGGATGAGGG - Intergenic
1097832127 12:64236371-64236393 GAGGAAGAAGAGGAGGAGGAAGG + Intergenic
1097842624 12:64336827-64336849 GAGGGAGAAGGGAAGGATGAAGG - Intronic
1097973290 12:65657962-65657984 CAGAGAAAAGAGGAGAACCAAGG - Intergenic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1098303235 12:69075819-69075841 CAGGGGGAAGAGGAGGATAATGG + Intergenic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098534227 12:71576464-71576486 CAGGGAAGAGAAGACCATGAGGG + Intronic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099851219 12:88099750-88099772 GAGGGAAAACAGGAGGCTGAGGG + Intronic
1099855342 12:88157541-88157563 TAGAGAAAAAAAGAGGATGAAGG - Intronic
1100067668 12:90669668-90669690 CAGTGAAAAGAGGAAGAAGAGGG - Intergenic
1101212789 12:102551396-102551418 GAGGTAACAGAGGAGGCTGAAGG + Intergenic
1101391736 12:104307103-104307125 CAGTAAAATGATGAGGATGATGG + Intronic
1101480677 12:105093728-105093750 CAGGGCAAAGAGGTGGTTAATGG - Intergenic
1101693578 12:107103484-107103506 AAGGGAATAGAGAAGGATGAGGG - Intergenic
1101711564 12:107271811-107271833 AAGGAAGGAGAGGAGGATGAAGG + Intergenic
1101887230 12:108676012-108676034 TAGGGAAAAGAAAATGATGAAGG + Intronic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102422532 12:112815195-112815217 CAGGGCACAGAGCAGGATGGAGG + Intronic
1102764793 12:115423208-115423230 GAGGAAAAAGAGGAGGAGGGAGG + Intergenic
1102788054 12:115620163-115620185 CTGGGAAAAGAGGAGAACCAAGG + Intergenic
1103430390 12:120879951-120879973 CAGGGAACAGAGGTGGAGTATGG - Intronic
1103617313 12:122162514-122162536 GAGGGAAAAGAGGAGGGAGCAGG - Intergenic
1103896639 12:124277756-124277778 GAGGAAGGAGAGGAGGATGAGGG - Intronic
1103896677 12:124277903-124277925 GAGGCAGAAGAGGAGGAAGAGGG - Intronic
1104160688 12:126177336-126177358 CAGGGAAAAGGGTGGGAAGAGGG + Intergenic
1104373299 12:128243174-128243196 CTGGGAAGACAGGAGGATGGTGG - Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104465387 12:128985682-128985704 GAGGGAGGAGGGGAGGATGAAGG - Intergenic
1104481413 12:129111207-129111229 CAGGGAACAGGGGAGGAAGAGGG + Intronic
1104649708 12:130522706-130522728 CAGGGAGAGGAGGAGGAGGTGGG + Intronic
1104690081 12:130819048-130819070 CAGGGCAGAGAGGTGGACGAAGG - Intronic
1104715436 12:131013116-131013138 CAGGGCCAGGAGGAGGGTGAGGG - Intronic
1105634124 13:22201058-22201080 CAAGTAAAACAGGAGGATTATGG + Intergenic
1105695448 13:22884046-22884068 CAGGGAAACGAGGTGACTGATGG + Intergenic
1105878964 13:24586756-24586778 CAGGAACAAGAGAAGAATGATGG + Intergenic
1105920874 13:24962294-24962316 CAGGAACAAGAGAAGAATGATGG - Intergenic
1106041896 13:26101488-26101510 CACAGAAAAGAGGAGGAGCAAGG + Intergenic
1106243082 13:27925456-27925478 GAGGGAGAAGAAGAGGAGGAGGG - Exonic
1106625462 13:31416640-31416662 TAGGTAGAAGAGGAGGAGGAGGG - Intergenic
1106660514 13:31794766-31794788 CAGGGAACAGGGTAAGATGAAGG + Intronic
1106856597 13:33860309-33860331 CAAGGGAAGGAGGAGGATGGAGG + Intronic
1106944044 13:34805560-34805582 CAGGGAAATGAGAAGAATGTTGG - Intergenic
1107584565 13:41830891-41830913 AAAAGAAAAGAGGAGGAGGAAGG + Intronic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1108577120 13:51800104-51800126 TAGGGAATAAAGGAGGAGGATGG + Intronic
1108727976 13:53201910-53201932 CAGGCAAAAGACGAGGACTAGGG + Intergenic
1108944148 13:56000495-56000517 CAGGGAGATGAGGAGGCTGCAGG - Intergenic
1109175199 13:59146468-59146490 CAGAGAAAAGAGCAAGATGATGG + Intergenic
1109393177 13:61720017-61720039 AAGGGAAGAGAAGAGAATGAAGG - Intergenic
1109704594 13:66073379-66073401 CAGGGAAAAGAGGATGGAGATGG + Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1109900700 13:68765727-68765749 CAGGGGAAATGGGAAGATGATGG + Intergenic
1110034764 13:70669308-70669330 GAGGGAAGAAAGGAGGATGAGGG - Intergenic
1110215509 13:73020609-73020631 CAGGTAATAGAGGAGGATGAAGG - Intergenic
1110390995 13:74973839-74973861 CAGGGAAGGGAGGAAGAGGAAGG + Intergenic
1110718707 13:78737532-78737554 CAGGGAAACCAGCAGGATCACGG + Intergenic
1111000261 13:82169736-82169758 CAGGGAAAAAGGGAGGAAGTAGG + Intergenic
1111315640 13:86555296-86555318 CAGGGAAGAGAGCAGGATCAAGG + Intergenic
1112202049 13:97286321-97286343 CAACGACAAGAGGAGAATGAAGG - Intronic
1112531327 13:100206742-100206764 CAGGGAAGAGAGGAAGGGGAAGG - Intronic
1112840546 13:103572255-103572277 AAGGGAAGAGAGGTGGAGGAAGG - Intergenic
1113046138 13:106157448-106157470 GAGGAAAAAGTGGAGGATGAGGG + Intergenic
1113129822 13:107023484-107023506 CAAGGGCAAGAGGAGGATGAAGG - Intergenic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114173752 14:20300410-20300432 CTGGGAAAGGAAGATGATGATGG - Intronic
1114191862 14:20445567-20445589 AAGGGAAATGAGGTGGATTATGG + Intergenic
1114201812 14:20528123-20528145 CAGGAAGGAGAGGAGGATGAAGG - Intergenic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114389572 14:22292408-22292430 AGGGGAAATGGGGAGGATGAGGG + Intergenic
1114397764 14:22382505-22382527 CAGGGAGAGGAGTAGGCTGATGG + Intergenic
1114455149 14:22849160-22849182 AAGGGGAAAGAGGTGGAAGATGG + Intergenic
1114479706 14:23025143-23025165 CAGGGGATAGAGGAGGTTGATGG - Intronic
1115178555 14:30594826-30594848 CAGTTAAAAGTGCAGGATGAAGG + Intronic
1115347726 14:32361166-32361188 GAGGGGAATGCGGAGGATGAGGG + Intronic
1115498288 14:34027456-34027478 AAGGGAGGAGAGGAGGAAGAAGG + Intronic
1115760964 14:36579562-36579584 GAGGAAGAAGGGGAGGATGAAGG - Intergenic
1116319002 14:43435653-43435675 TAGGGAAAAGGGAAGGGTGAGGG + Intergenic
1116475137 14:45331204-45331226 GAAGGAGAAGAGGAGGAAGAAGG - Intergenic
1116701399 14:48247870-48247892 CAGGATAAGGATGAGGATGAAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117206623 14:53450075-53450097 CAGGGCAAAGAGGAGATGGATGG + Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117661731 14:58013677-58013699 CAGGGAAAAGATGAGGAAACTGG + Intronic
1117667319 14:58070200-58070222 CAGCTCAAAGAGGAGGAAGAAGG + Intronic
1117745495 14:58865361-58865383 CAAGGAAAATAGGTGGATGTGGG + Intergenic
1117937797 14:60926784-60926806 TAGGGAAGGGAGGAGGCTGAAGG - Intronic
1118378520 14:65198495-65198517 CAGGCAAAGGAGGGGGATGCTGG + Intergenic
1118979071 14:70701601-70701623 TAGGGAAAAGAGGGGGAAGAGGG + Intergenic
1119129875 14:72162319-72162341 CAGGGAATAGAGGTGGGTCAGGG - Intronic
1119180384 14:72601044-72601066 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1119192258 14:72690962-72690984 CAGGGAAAAGAGGAGAGAAAGGG + Intronic
1119276589 14:73362379-73362401 GAGGGAAAAGAGGAGGAAAAGGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119793527 14:77376235-77376257 CCTGGACAAGAAGAGGATGAGGG + Intronic
1119996831 14:79262438-79262460 GAGGAGAAAGAGGAGGAGGAAGG + Intronic
1120053244 14:79892823-79892845 GATGGAAAAATGGAGGATGAGGG - Intergenic
1120111021 14:80556512-80556534 GAGGGAAAAGTTGAGGAAGACGG + Intronic
1120238784 14:81925311-81925333 CAGGGAAAAGCAGAGGAGAATGG - Intergenic
1120525162 14:85568918-85568940 GAGGGAAAAGAGGAGACAGACGG - Intronic
1120739530 14:88092179-88092201 CAATGAAAAAAGGAGGATGTGGG + Intergenic
1120895422 14:89527072-89527094 AAGGGAGGAGAGGAGGAGGAAGG + Intronic
1120913673 14:89690743-89690765 AAGGGCAAAGAGGAGGAAGCAGG + Intergenic
1121006773 14:90495730-90495752 CAAGGAAAACAGTGGGATGATGG + Intergenic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1123108047 14:105852184-105852206 CAGGAGGAAGAGGACGATGAAGG + Intergenic
1123473524 15:20571437-20571459 CAGGGAAACGAAGAGCATAAAGG - Intergenic
1123644485 15:22428916-22428938 CAGGGAAACGAAGAGCATAAAGG + Intergenic
1123665801 15:22608824-22608846 CAGGGAAACGAAGAGCATAAAGG + Intergenic
1123733822 15:23166448-23166470 CAGGGAAACGAAGAGCATAAAGG - Intergenic
1123751959 15:23363829-23363851 CAGGGAAACGAAGAGCATAAAGG - Intronic
1123800632 15:23816214-23816236 CTGGGTAATGAGGAGCATGAGGG + Intergenic
1124121640 15:26893682-26893704 CAGGGGAAACAGGAGGATCTGGG + Intronic
1124153103 15:27199932-27199954 CAGGAAAGAGAGAAGGATGAAGG - Intronic
1124284324 15:28387753-28387775 CAGGGAAACGAAGAGCATAAAGG - Intronic
1124298373 15:28523861-28523883 CAGGGAAACGAAGAGCATAAAGG + Intronic
1124319623 15:28703237-28703259 CAGGGAAACGAAGAGCATAAAGG + Intronic
1124354572 15:28985162-28985184 CTGGGAGAAGAGGAGGAGGTGGG + Intronic
1124482888 15:30092193-30092215 CAGGGAAACGAAGAGCATAAAGG - Intronic
1124489341 15:30144264-30144286 CAGGGAAACGAAGAGCATAAAGG - Intronic
1124520688 15:30405025-30405047 CAGGGAAACGAAGAGCATAAAGG + Intronic
1124537970 15:30561194-30561216 CAGGGAAACGAAGAGCATAAAGG - Intronic
1124544431 15:30613255-30613277 CAGGGAAACGAAGAGCATAAAGG - Intronic
1124564393 15:30800692-30800714 CAGGGAAACGAAGAGCATAAAGG - Intergenic
1124754188 15:32394063-32394085 CAGGGAAACGAAGAGCATAAAGG + Intronic
1124760680 15:32446391-32446413 CAGGGAAACGAAGAGCATAAAGG + Intronic
1124777951 15:32602671-32602693 CAGGGAAACGAAGAGCATAAAGG - Intronic
1124957730 15:34370763-34370785 AAGGGAAAGGAGGAGGAAGAAGG - Intergenic
1125255620 15:37759651-37759673 CAGGGAACAGCAGTGGATGATGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125494838 15:40182742-40182764 CTGGGAAAAGAGGACTCTGAAGG - Intronic
1125511840 15:40296408-40296430 GAGGGCAAAGAAGAGGAGGATGG + Intronic
1125547284 15:40515320-40515342 AAAGAAAAAGAGGAGGAAGAGGG - Intergenic
1125731320 15:41894158-41894180 CGGGGAAGGGAGGATGATGAAGG - Intergenic
1125751359 15:42031523-42031545 TGGGAGAAAGAGGAGGATGAAGG - Intronic
1126658937 15:51012280-51012302 AAGGGAAAAGAGGAGGTTCTTGG - Intergenic
1126892015 15:53216584-53216606 CAAGGAGAAGAGATGGATGATGG - Intergenic
1127556076 15:60088975-60088997 CAGGGAGGAGAGGAGAAGGAAGG + Intergenic
1127687925 15:61366550-61366572 CAGGGTGAAGACTAGGATGAGGG + Intergenic
1127908404 15:63394963-63394985 CTGGGCAACTAGGAGGATGATGG - Intergenic
1127964982 15:63916565-63916587 CTGGGAAAACAGGTGGGTGAAGG - Intronic
1128142710 15:65313459-65313481 CAGGGAAAAGAACATGAAGATGG - Intergenic
1128349271 15:66878180-66878202 CAGAGAGAAGAGGAGAAGGAGGG + Intergenic
1128715363 15:69903823-69903845 CAGGGCAGAGAGCAAGATGAAGG - Intergenic
1128780737 15:70357169-70357191 CAGGGAACAGAGGAGGGGGTGGG + Intergenic
1129210437 15:74064983-74065005 GAAGGAAAAGGGGAGGAAGATGG - Intergenic
1129403578 15:75300390-75300412 GAAGGAAAAGGGGAGGAAGATGG + Intergenic
1129626273 15:77203196-77203218 CAGGCAGAAGAGGAGGTGGAAGG + Intronic
1129705378 15:77791230-77791252 GAGGGACAAGAGGATGAGGAGGG + Intronic
1129843646 15:78758442-78758464 CAGGGAACAGATGGGCATGAAGG - Intergenic
1130033896 15:80340958-80340980 CAGGAAACAGAGGAGGAGAAGGG + Intergenic
1130109758 15:80954474-80954496 CAGGGAAAGGAGTAGGATGTGGG + Intronic
1130168923 15:81491804-81491826 CAGGAAAAAGTGGAGAATAAGGG + Intergenic
1130258158 15:82335358-82335380 CAGGGAACAGATGGGCATGAAGG + Intergenic
1131212545 15:90510372-90510394 CAGGGCACAGGGGAGGGTGAGGG - Intergenic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1131612864 15:93983376-93983398 CAGTGAAAAGGAGAGGCTGAAGG - Intergenic
1132016216 15:98319766-98319788 TATGGAAAAGAGGAGGAGGGAGG + Intergenic
1132284369 15:100650439-100650461 CAGGGATAGGAGGAGGCAGAGGG + Exonic
1132294133 15:100722964-100722986 GAGGGAGAAGAGGGGAATGAAGG - Intergenic
1132906405 16:2284888-2284910 CAGGTACATGAGGGGGATGATGG + Exonic
1133000796 16:2850480-2850502 GAGGAAAAAGAGGAAGACGAGGG + Intergenic
1133030454 16:3008431-3008453 CTGGGAAAAGAGGTGGGGGAGGG - Intergenic
1133103747 16:3494134-3494156 CAGGGGAGGGAGGAGGTTGAGGG + Intronic
1133230148 16:4362531-4362553 TAGGGTACACAGGAGGATGACGG + Intronic
1133288136 16:4700575-4700597 CACAGAAAGGAGGAGGATGGTGG + Intronic
1133443721 16:5841996-5842018 CAGGGAGAGGAGGATGAGGATGG - Intergenic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1133569793 16:7030018-7030040 ATGGGAAAAGTGGAGGATGGTGG + Intronic
1134187860 16:12098618-12098640 CAGGCAAAAGAGGAGGAGAGGGG - Intronic
1134340859 16:13344439-13344461 AAGGGCATAGAGGAGGAAGAAGG - Intergenic
1134438082 16:14280096-14280118 CTTGAAAAAGAGGAGGACGAAGG + Intergenic
1134533982 16:15010013-15010035 CAGGGAAAAGAAGTACATGAAGG - Intronic
1134800185 16:17077028-17077050 GAGAGGAAAGAGGTGGATGATGG - Intergenic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1135472569 16:22744490-22744512 CAGAGAAAGGAAGAGGATGGAGG + Intergenic
1135544781 16:23358261-23358283 CAGGGAAAATAGCTGGCTGATGG + Intronic
1135783514 16:25327128-25327150 CAGGCAAAAGGGGTGAATGATGG + Intergenic
1136054489 16:27678364-27678386 GAGGGAAAAGAAGACGAAGAGGG - Intronic
1136081319 16:27854251-27854273 AAGGCAAAAGGGGAGGAGGAGGG + Intronic
1137375369 16:47947566-47947588 GAAGGAAAAGAGGAGGGGGAAGG - Intergenic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1137539635 16:49353409-49353431 GGAGGAAAAGAGAAGGATGAAGG - Intergenic
1137911921 16:52386151-52386173 CACGGAAAAGAGCAGGCTGGTGG + Intergenic
1138153982 16:54685917-54685939 GAGGGAGAAGAAGAGGAAGAAGG - Intergenic
1138205982 16:55125408-55125430 CTGGGATAAGCAGAGGATGAGGG + Intergenic
1138247553 16:55479028-55479050 CGGGGAAAAGAGGTGGAGAAAGG + Exonic
1138292661 16:55861295-55861317 CATAGAAAAGAGGAGGATTGAGG - Intronic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138326444 16:56175019-56175041 GTGGGAAAGGGGGAGGATGAGGG - Intergenic
1138535761 16:57659544-57659566 CAGGGAGAAGTGCAGGAAGATGG - Exonic
1138667789 16:58586440-58586462 CAGGGAGGAGGGGAGGGTGAGGG + Intronic
1139365407 16:66429416-66429438 CAGGGGATAGGGGAGGATGCTGG + Intronic
1139424964 16:66873799-66873821 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1139605158 16:68013028-68013050 GAGAGAAAAGAGGAAGAAGAAGG + Intronic
1139862057 16:70030708-70030730 CAGGGAAAAGAAGTACATGAAGG + Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140465355 16:75176791-75176813 AAGGGAAAAGAGGAATAGGAAGG + Intergenic
1140684748 16:77422609-77422631 GAGAGAAAAAAGGAGGAAGAAGG + Intronic
1140830425 16:78745748-78745770 GGGGAAAAAGAGGAGGAAGAGGG - Intronic
1140964404 16:79950885-79950907 GAGGTAAAAGAGAAGAATGAGGG + Intergenic
1141645531 16:85365382-85365404 CAGGGAAAAGAGAAGAGTGAAGG - Intergenic
1141862710 16:86728888-86728910 AAGTGAAAAGAGGTGGATGCTGG + Intergenic
1141865324 16:86746172-86746194 GAGGGAAAGGAGGAGGATCTGGG + Intergenic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142606374 17:1083642-1083664 CAGGGAACAGAGGGAGAGGAGGG + Intronic
1143091264 17:4450253-4450275 GAGAGAAAAGAGGAGGAAGGAGG - Intronic
1143554808 17:7653374-7653396 GAGGTAGAAGAGGAGGATAAAGG - Exonic
1143632291 17:8146202-8146224 CAGGGAAAAGGGGAAGGGGATGG + Intronic
1143865792 17:9922263-9922285 CTTGGAAAAGATGAGGAAGAGGG + Intronic
1143902003 17:10181430-10181452 AAGGGTAAAGAAGAGGATGGGGG + Intronic
1144096142 17:11902419-11902441 CATGGAAAAGAGGGGCAAGAAGG - Intronic
1144279619 17:13712409-13712431 GAGGGAAAAGAAGAGGAAGGTGG + Intergenic
1144305213 17:13963750-13963772 CAAGGGAAAGGGGAGGATGAAGG - Intergenic
1144422846 17:15113855-15113877 CAGGGAAGAGATGAGGAGGCTGG + Intergenic
1144580437 17:16456077-16456099 GAGGGAGAGGAGGAGGAGGAAGG + Intronic
1144610376 17:16706893-16706915 CTGGGGAAAGATGAGGATGAGGG + Intronic
1144764553 17:17725406-17725428 CCGGGAGGAGAGGAGGATGAAGG + Intronic
1144902366 17:18608522-18608544 CTGGGGAAAGATGAGGATGAGGG - Intergenic
1144928696 17:18837456-18837478 CTGGGGAAAGATGAGGATGAGGG + Intergenic
1145130132 17:20337581-20337603 CTGGGGAAAGATGAGGATGAGGG + Intergenic
1145404143 17:22570947-22570969 GAGGAAAAAGAGGGAGATGATGG + Intergenic
1145798608 17:27669772-27669794 CAGGGCCAAGAGGAGGAAGCAGG + Intergenic
1146176202 17:30667884-30667906 GAGGGAAAAGTGGAGGGTGATGG - Intergenic
1146349660 17:32083995-32084017 GAGTGAAAAGTGGAGGGTGATGG - Intergenic
1146435215 17:32839594-32839616 CAGAGAAAGGCAGAGGATGAAGG + Intronic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146456952 17:33015990-33016012 CTTGGCAAAGAGGAGGACGAAGG - Exonic
1146497209 17:33333788-33333810 GAGAGGAAAGAGGAGGATTATGG + Intronic
1146575887 17:33991203-33991225 CACTGAAAAGATGAGGATGATGG + Intronic
1146620285 17:34391796-34391818 CAGGGGCAAGATGAGGAAGAGGG + Intergenic
1147579981 17:41622735-41622757 CAGGGAATAGAAGAGAAGGAGGG - Intronic
1147667966 17:42160545-42160567 CTGGGAAAAAGGCAGGATGAGGG + Intronic
1147924283 17:43937193-43937215 CAAGAAAAAGAGCAAGATGAGGG + Intergenic
1147962367 17:44175856-44175878 TAGGGGAAAGTGGAGGAGGATGG + Intronic
1148119314 17:45198198-45198220 GGGGAAAAAGAGTAGGATGAAGG + Intergenic
1148177942 17:45584306-45584328 GAGGAAAAAGAGGAGGTTGGCGG + Intergenic
1148193991 17:45700171-45700193 AAGGGAGAGGAAGAGGATGATGG - Intergenic
1148812097 17:50299966-50299988 CAGGGAAAAGGGGTGGGTGATGG - Intergenic
1149422099 17:56521055-56521077 GAGGGAGAAGAGGAGGTTTATGG + Intergenic
1149923398 17:60679279-60679301 AAGGGAAAAAAGGAGGAAGTAGG - Intronic
1150023933 17:61651943-61651965 CAGGGGAATGATGAGAATGATGG + Intergenic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150432247 17:65127698-65127720 GATGGACAAGAGGAGGATGTGGG + Intergenic
1150702276 17:67458193-67458215 AAGGAAAAAGAGGAGGAAGCAGG - Intronic
1150792059 17:68206486-68206508 GAGGAAAAAGAGGAGGTTGGGGG - Intergenic
1151185616 17:72361893-72361915 GAGGGAAAAGAGGAGGGAGCTGG - Intergenic
1151362952 17:73599573-73599595 GAGGGAAAAGAGGAGGAGAGAGG + Intronic
1151454554 17:74218195-74218217 GAGGGAAAAGAGGAGCAGGTAGG - Intronic
1151524283 17:74653264-74653286 AAGGGAAGAGAGGAAGAGGAGGG + Intergenic
1151550931 17:74822109-74822131 AAAGGAGAAGAGGAGGCTGAGGG + Intronic
1151837035 17:76588549-76588571 CTGGGAAAAGAGGAGGCTTGAGG - Intergenic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152453782 17:80401086-80401108 GAGGGAAAGGAGGAGGATTTGGG - Intergenic
1152829154 17:82486531-82486553 CACTGACAAGAGGAGGGTGAGGG + Intronic
1152856488 17:82667605-82667627 CAGGAGACAGAGGAGGATGCGGG - Intronic
1153321243 18:3776104-3776126 GAGGGAAAAGACGGGGAAGATGG + Intronic
1153396732 18:4630513-4630535 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1153492636 18:5665125-5665147 CTGGGAAAACAGGAAGATAATGG + Intergenic
1153682664 18:7515191-7515213 GAGGGAAAAGAAGAAGAGGAAGG - Intergenic
1153782593 18:8507195-8507217 CAGGGGGAAGAGGAGGGTGTTGG + Intergenic
1154092404 18:11378098-11378120 GAGGGCAAAGAGGAGAAGGAGGG + Intergenic
1155404999 18:25478119-25478141 CAGGGGAAGGAGGAGGTTTACGG - Intergenic
1155495687 18:26439620-26439642 CAAGAAAAAGAGGAGGAAGCTGG - Intergenic
1155576403 18:27252505-27252527 GGGGGGAAAGAGGAGGAGGAAGG + Intergenic
1155578144 18:27271521-27271543 AAGGGACAAGATGAGGTTGAAGG - Intergenic
1155928601 18:31684355-31684377 GAGGGAGAAGAAGAAGATGAAGG + Exonic
1156080577 18:33329822-33329844 AAAGGAAAAGAGGAAGAGGAAGG - Intronic
1156520647 18:37719934-37719956 CAACAAAAGGAGGAGGATGAAGG + Intergenic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1156961298 18:43034908-43034930 CAAGGCACAGAGGAGGAGGAAGG - Intronic
1157145554 18:45158977-45158999 GAGGGAAAGGAGGAGGAGAAAGG - Intergenic
1157439131 18:47696878-47696900 CAGGGCAAAGAGGAGGGGGTGGG - Intergenic
1157551227 18:48583053-48583075 GAGGGGAGGGAGGAGGATGATGG + Intronic
1157618732 18:49003220-49003242 CAGGTAGAAGGGGAGGAAGAGGG - Intergenic
1157674869 18:49561571-49561593 GAGGGAGAAGAGGAGGACAAAGG + Intronic
1157731959 18:50011694-50011716 GAGGGAAAGGAGGAGGAACAGGG - Intronic
1158275190 18:55759216-55759238 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1158562915 18:58530618-58530640 CAAGGAAAATTGGAGGATGGCGG + Intronic
1158588827 18:58762853-58762875 CAGGGAATACAGGAGGAAAATGG - Intergenic
1158937011 18:62373829-62373851 CTGAGGACAGAGGAGGATGAGGG - Intronic
1159040466 18:63319595-63319617 CAGGGGAGAGGGGACGATGAAGG + Exonic
1159594802 18:70372321-70372343 CAAGGAAGAGAGGAGGCTGCAGG + Intergenic
1159833125 18:73303061-73303083 CAGGATGAGGAGGAGGATGAGGG - Intergenic
1160629856 18:80239210-80239232 CAGGGAGAAGAGGGGGTCGAAGG + Intronic
1160819718 19:1052362-1052384 GAGGGGGAAGAGGAGGAGGAGGG + Intronic
1160844359 19:1159930-1159952 CAGGGAAGGGAGGTGGGTGAGGG + Intronic
1160965734 19:1746195-1746217 GAGGGAGAGGAGGAGGAGGATGG + Intergenic
1160965798 19:1746366-1746388 GAGGGAGAGGAGGAGGAGGATGG + Intergenic
1161221409 19:3119836-3119858 TAGGGCACAGAGGAGGATGCAGG - Intronic
1161795094 19:6381779-6381801 CAGGAAAAAGAAGAAGAAGAAGG - Exonic
1161966832 19:7553795-7553817 GAGGAAGAAGAGGAGGAGGAGGG + Intronic
1162227638 19:9237199-9237221 AAGGGAAAAGAGAAGTAAGAAGG - Intergenic
1162462283 19:10820286-10820308 CTGGGCAGAGATGAGGATGAAGG + Intronic
1162716327 19:12636684-12636706 GAGGGGAAAAAGGGGGATGAAGG - Intronic
1162943516 19:14028462-14028484 CAGAGATAAGAGGAGGTTGCTGG + Intronic
1162982618 19:14249022-14249044 GAGGGAAAAGTGGAGGGTGATGG + Intergenic
1163179966 19:15592348-15592370 CAGGGAAAAGAGGAGAGTACAGG - Intergenic
1163300585 19:16443220-16443242 CAGGGAAAAGAGGACTATCTTGG + Intronic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1164335596 19:24316314-24316336 CAGGAAAAAAAGGAGAAGGAAGG + Intergenic
1164441704 19:28284492-28284514 AAGGGGAAAGAGGAGGTGGAGGG + Intergenic
1164696047 19:30245157-30245179 CAGGTAAAAGGTGAGGATGAGGG - Intronic
1164858223 19:31541920-31541942 CATGGAAAAGAGGAGGCAGAAGG + Intergenic
1164937041 19:32223150-32223172 AAGAGAAAAGAGGAGGAGAAAGG + Intergenic
1164937051 19:32223225-32223247 GAGAGAAAAGAGGGGGAGGAAGG + Intergenic
1165148532 19:33748023-33748045 CAGGAAGAGGAGGTGGATGAGGG + Intronic
1166960294 19:46492923-46492945 GAAGGGAAAGAGGAGGAGGAGGG - Exonic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167268472 19:48494730-48494752 CAGGGGCAAGAGGAGGGTGGAGG + Intronic
1167608200 19:50492902-50492924 GAGGGAAAGGAGGAGGAAGGAGG + Intergenic
1167646519 19:50708593-50708615 CATGGAAAGGATGAGGATGGAGG + Intronic
1167706388 19:51083642-51083664 CAGGGAACAGAAGAGGCAGACGG + Intronic
1167712550 19:51121377-51121399 CATGCATAAGAGGAGGATCAAGG - Intergenic
1168136617 19:54356210-54356232 CAGGTAAAGGGGGAGGAGGAGGG - Exonic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
925011014 2:486306-486328 CTGGCAAAAGAGGAGGCTGGGGG - Intergenic
925198681 2:1948631-1948653 CTGGAAAGAGAGGAGGATGTGGG + Intronic
925383747 2:3447464-3447486 GAGAGAGAAGAGGAGGAGGAGGG + Intronic
925413080 2:3651196-3651218 GTGGGAAAAGAGGACGAGGACGG + Intergenic
925447998 2:3944170-3944192 CAGGGACGAGGGGAGGAGGAAGG - Intergenic
925448674 2:3950576-3950598 CAGGCAAAAGCGCAGGACGAAGG - Intergenic
926301225 2:11604472-11604494 GAGAGAAGAGAGGATGATGATGG - Intronic
926447970 2:12968040-12968062 AAGGGAAAAGAGAAGTCTGAGGG + Intergenic
926690795 2:15731988-15732010 CAGGGAAAAGCAGAGGAAGGAGG - Intronic
926691239 2:15735499-15735521 CAGGGATAGAAGGAGGCTGAAGG - Intronic
926803424 2:16682830-16682852 CAGGGAAAAGGAGAGGATGACGG + Intergenic
927001736 2:18802594-18802616 CAGGGGAAAGAAAAGGATAATGG + Intergenic
927253583 2:21019987-21020009 GAGGGAAGACAGGAGGATAAGGG - Intronic
927382568 2:22496138-22496160 CAGGAAAGAGAGGACAATGAGGG - Intergenic
927783488 2:25956736-25956758 CAGGGCTAGGAGGAGGATGGGGG + Intronic
927862709 2:26570190-26570212 CAGGGAGCAGAGGAGGAGTATGG + Intronic
928117916 2:28560992-28561014 CAGGAATAACAGGAGGATGAGGG - Intronic
928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG + Intronic
928270057 2:29847869-29847891 GAGGAAGGAGAGGAGGATGAGGG + Intronic
928413154 2:31069961-31069983 CCGAGAGAAGAGGAGGAGGATGG + Intronic
928534544 2:32227372-32227394 CAAGGAACAGAGGAGGTGGAAGG - Intronic
928623297 2:33113388-33113410 CAGGAAAGAGATGAGGATGGAGG + Intronic
928704334 2:33931410-33931432 CAGGAAAAAGAGCAGCAAGATGG - Intergenic
928704497 2:33933378-33933400 CAGGCAAAAGAGCAGCAAGATGG - Intergenic
928859076 2:35834028-35834050 CAGGGAAAACAGGAAAATCATGG + Intergenic
928997935 2:37315597-37315619 CAGAGAAAACAGGAGGTAGAGGG - Intronic
929222893 2:39483733-39483755 CAGAGAGAAGAGGAAGAGGAAGG - Intergenic
929242237 2:39665554-39665576 AAGGGGAGAGAGGAGGATGAGGG + Intronic
929408407 2:41669177-41669199 TAGGGAAAGGAGGAGGAAGGAGG - Intergenic
929430454 2:41881992-41882014 AAGGAAAGAGAGAAGGATGATGG - Intergenic
929444503 2:41991951-41991973 GAGGGAGAAGAGGAGGGGGAGGG + Intergenic
929532998 2:42763971-42763993 GAGGGAGCAGAGGAGGGTGAGGG + Exonic
929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG + Intergenic
929656019 2:43732511-43732533 CATGGAAAATGGGATGATGAAGG - Intronic
930139595 2:47938506-47938528 CTTGGGAAAGAGGAGGAGGAGGG - Intergenic
930170980 2:48251618-48251640 CAGGAAGAAGGGAAGGATGAAGG - Intergenic
930241552 2:48940887-48940909 CAAGGGAAAGAAGAGGAGGAGGG - Intergenic
930376367 2:50572100-50572122 CAGAGAAAACAGGAGGACTAAGG + Intronic
931316509 2:61137754-61137776 CTGGGAAAAGAAGAGGATGCAGG - Intronic
931376389 2:61712179-61712201 CAGAGGAGAGAGGATGATGATGG - Intergenic
931428374 2:62191165-62191187 CACAGAGAAGAGGAAGATGAAGG - Intergenic
931782291 2:65589136-65589158 GAGAGAAATGAGGATGATGATGG + Intergenic
932502701 2:72197979-72198001 CAGAGCAAAGAGGAGAATGTTGG + Intronic
932569280 2:72929521-72929543 CAGGGAAGAGAGAAAGCTGAGGG + Intronic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
932893104 2:75612882-75612904 AAGGGACAAAAGGAGGAAGATGG + Intergenic
933888129 2:86739412-86739434 CAGGAAAAAAAGGAGGAGAAGGG - Intronic
933922049 2:87057294-87057316 CAGGAAAAAAAGGAGGAGAAGGG + Intergenic
934149114 2:89128581-89128603 GAGAGTAAAGAGGAAGATGATGG - Intergenic
934218181 2:90053461-90053483 GAGAGTAAAGAGGAAGATGATGG + Intergenic
934509795 2:94928464-94928486 CAAGTAAAAGAGGAGGCGGACGG + Intergenic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934883491 2:98004688-98004710 AAGGGAGAGGAGGAGGAGGAGGG - Intergenic
935622799 2:105144034-105144056 GAGGGAGAGGAGGAGGAGGACGG - Intergenic
935687888 2:105700394-105700416 CAGATATAAGAGGAGGAAGATGG - Intergenic
935990241 2:108712793-108712815 CAGGTCAAAGATGAGAATGATGG + Intergenic
936079236 2:109421109-109421131 CATGGAAAAGTGGGGGGTGATGG + Intronic
936703953 2:115048193-115048215 AAGGGAAAAGAAGCTGATGATGG - Intronic
936923313 2:117711223-117711245 CAGAAGAAAGAGGAAGATGAGGG + Intergenic
937027450 2:118711265-118711287 CAGGGAGAAGAGGAGGTTGGTGG - Intergenic
937049745 2:118878806-118878828 CAGGGAAGGGTGGAGCATGAGGG - Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
938042784 2:128090165-128090187 GAGGAAGGAGAGGAGGATGAAGG - Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938120089 2:128627001-128627023 GAGGGAGAGGAGGAGGAGGAGGG + Intergenic
938582726 2:132661727-132661749 CTGGGAAAAGGGGAAAATGAGGG + Intronic
938828523 2:135031210-135031232 AAGTGAATACAGGAGGATGATGG + Intronic
939045475 2:137245056-137245078 GAGGGAGACGAGGAGGAGGAGGG - Intronic
940775027 2:157876122-157876144 CGGGGTGAAGAGGAGGAGGAAGG + Intergenic
941105819 2:161351585-161351607 CAGGGGAAAGAGGAGGGTAAGGG - Intronic
941412014 2:165169953-165169975 AAGGGAAAAGGGAAGAATGAAGG + Intronic
941591130 2:167422061-167422083 GAGGAAGAGGAGGAGGATGAGGG + Intergenic
941601326 2:167546925-167546947 CAAGGGAAAGTGAAGGATGAGGG - Intergenic
941764653 2:169283978-169284000 CAGGGAAGCGAGGAGGGTGAAGG - Intronic
941959731 2:171241740-171241762 AAGAGAAAAAAGGAGGGTGAGGG - Intergenic
942623589 2:177875264-177875286 CAGGGAAAAGAGGAAGCTAAAGG + Intronic
942725289 2:178999850-178999872 CAAGTAAGAGGGGAGGATGAGGG - Intronic
943044076 2:182837522-182837544 CAGGAAAAAGAGGAGGTAAAAGG - Intronic
943795468 2:191987245-191987267 GAGGGAAATGAGGAGGAGGAAGG + Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944162501 2:196679320-196679342 CAGGGGAAGGAGGTGGAAGAAGG - Intronic
944727939 2:202490745-202490767 AAGGGTAAAGAGTAGGATTAGGG + Intronic
944926313 2:204468305-204468327 GATGGAAAAGGAGAGGATGAAGG + Intergenic
945416320 2:209577346-209577368 CTGGGGAGAGAGGATGATGATGG + Intronic
945988967 2:216377583-216377605 GAGGAAGAAGAGGAGGAGGAGGG + Intergenic
946226980 2:218269477-218269499 GAGGAAGAAGAGGAGGAAGAGGG - Exonic
946361856 2:219223702-219223724 CAGGCAGAAGATGAGGATGAGGG + Exonic
946492232 2:220159969-220159991 GAGGAAAAAGAGGAGTAGGAGGG - Intergenic
946832654 2:223741839-223741861 GAGGAAAGAGAGGAGGAGGAAGG - Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947602221 2:231460668-231460690 GAGGAAGAAGAGGAGGAGGAAGG - Exonic
948430618 2:237916255-237916277 AAGGGAAGAGACGAGGGTGATGG + Intergenic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
1168739234 20:174071-174093 GAGGGAAAGAAGGAGGATGTGGG - Intergenic
1168996576 20:2137537-2137559 TAGGAAAAAGAGGAGCAAGAGGG - Intronic
1169672494 20:8118056-8118078 CAGGGAAAGGAGGAGAATTAGGG + Intergenic
1169752146 20:9005258-9005280 CAGTGACAAGAGGAGAATGAGGG + Intergenic
1169790023 20:9400199-9400221 CAGGCACAGGAGGAGGGTGAGGG - Intronic
1169863222 20:10173222-10173244 CAGGGAAAAGCAGTGGATGCAGG - Intergenic
1169966369 20:11222245-11222267 TAGGGAAAAGATGAGGAAGGGGG + Intergenic
1169975129 20:11316674-11316696 CATGGAGAAGAGGAGGAAGTTGG + Intergenic
1170034309 20:11973845-11973867 AAGGAAGAAGAGGAGGAAGAAGG + Intergenic
1170141561 20:13129986-13130008 GAGGCAAAATAGGAGAATGAGGG + Intronic
1170172094 20:13426072-13426094 GACTGAAAAGAGGAGGATGTGGG + Intronic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1170444027 20:16406367-16406389 CAGGGAGAAGAGGAAGGTGAGGG - Exonic
1170545538 20:17432966-17432988 CAGGGACAAGAGGCGCCTGAGGG + Intronic
1170596033 20:17806634-17806656 CAGGGTAAGGAGGAGAAAGAAGG + Intergenic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1171056308 20:21910259-21910281 CAAAGTAAAGAGGAAGATGAAGG - Intergenic
1171163611 20:22951391-22951413 CAAGGCAAAGAGGAAGAAGATGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171370872 20:24661321-24661343 GAGGGAAGAGAGGGGGAGGAAGG + Intronic
1172250855 20:33478121-33478143 TATGGAAAAGAGCAGGATGAAGG - Intergenic
1172525323 20:35597499-35597521 CAGGGGAAGGAGGATGATGGTGG - Intergenic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1173126412 20:40340162-40340184 AAGGGAAGAGAGGAGTAAGATGG + Intergenic
1173352282 20:42256160-42256182 TAGGGAAAAGATGAAGATGCTGG + Intronic
1173409697 20:42799141-42799163 GAGGGAAAAGGGGAAGAGGATGG + Intronic
1173575025 20:44107352-44107374 CAGGGAGAAGAGAAGGATGTGGG - Intergenic
1173838154 20:46139125-46139147 CTGGGCAAAGAGGAGGGAGAGGG - Intergenic
1174641774 20:52050482-52050504 GAGGAGAAAGAGGAGGAGGAAGG - Intergenic
1175120149 20:56710796-56710818 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120174 20:56710871-56710893 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120200 20:56710946-56710968 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175298882 20:57928758-57928780 AAGAGAAAGGAGGAGGAAGATGG - Intergenic
1175490979 20:59381147-59381169 CAGGGAGCAGAGAAGGGTGAAGG - Intergenic
1175571525 20:60026424-60026446 GAGGGAGAAGAGGAGGCAGAAGG + Intronic
1175579895 20:60090272-60090294 CAAGAAGAGGAGGAGGATGAAGG - Intergenic
1175861349 20:62151917-62151939 GAGGGAAAAGAGGAGAACGGGGG - Intronic
1176094849 20:63335902-63335924 CAGGAAGAAGAGGAGGGAGAAGG + Intergenic
1176307499 21:5131587-5131609 CAGGGAAAAGAGGAAAAAAATGG - Intronic
1176605229 21:8824717-8824739 CAGGTAAAAGAGGAGGTGGATGG - Intergenic
1177004044 21:15648725-15648747 CAGTGAGAAAAGGAGGAAGAGGG - Intergenic
1177013454 21:15755862-15755884 AAGGGAGAAGTGGAGGATGCAGG + Intronic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178055670 21:28796009-28796031 CAGAGAAAACAGGAGGTAGAGGG - Intergenic
1178191161 21:30282649-30282671 CAGGGCACAGAGGAGTTTGACGG + Exonic
1178894548 21:36548135-36548157 CAAGGAAAAGAGGAGACAGAGGG - Intronic
1179271434 21:39854082-39854104 CAGGGACAAGAAGAGACTGATGG - Intergenic
1179721367 21:43317945-43317967 CAGGAAAGAGGAGAGGATGAAGG + Intergenic
1179849561 21:44130443-44130465 CAGGGAAAAGAGGAAAAAAATGG + Intronic
1179887702 21:44321474-44321496 CAGGCAACAGAGGAGGCAGAAGG - Intronic
1180347524 22:11716322-11716344 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1180355289 22:11834432-11834454 CAAGTAAAAGAGGAGGTGGACGG - Intergenic
1180382962 22:12157895-12157917 CAAGTAAAAGAGGAGGTGGACGG + Intergenic
1180560789 22:16612823-16612845 GAGGGAAAGGAGGAGGATCTGGG - Intergenic
1180660627 22:17463854-17463876 CAGGGAAAAGAAGAGGTCCAAGG + Intronic
1180945156 22:19688618-19688640 CGGGGGGAAGAGGAGGCTGAGGG - Intergenic
1181097746 22:20517508-20517530 CAGTGAAAAGAGCAGGGTGGTGG - Intronic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1181507319 22:23368663-23368685 CATGGAAAAGAGGAGGACTGGGG - Intergenic
1181542382 22:23580309-23580331 CAGGGACCAGAGGATGAGGATGG - Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182187658 22:28423714-28423736 TATGACAAAGAGGAGGATGATGG + Intronic
1182512479 22:30828927-30828949 GAGGGAAAAGAGGGTCATGATGG + Intronic
1182986466 22:34722606-34722628 CAGGAAACTGTGGAGGATGAAGG - Intergenic
1183017698 22:35003170-35003192 CTGGGAGCAGAGGAGGGTGAGGG + Intergenic
1183144275 22:35974852-35974874 TAGGGAAAAGATGAGGCTGCAGG - Intronic
1183177750 22:36237015-36237037 GAGGGAGAAGAGGAGCAGGAGGG + Intronic
1183206936 22:36426251-36426273 CAGGGAGAGGAGGAAGAGGAAGG - Intergenic
1183283391 22:36946490-36946512 CAGGGAATTGAGGAGCATTAAGG + Intergenic
1183328157 22:37205465-37205487 AAGGGAGAAGAGGAAGAGGAAGG - Exonic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183652998 22:39169754-39169776 CTGGAAAAAGGGGAGGAGGAGGG - Intergenic
1183843942 22:40524724-40524746 CAGTTAAAAGAGGAAGAAGATGG - Intronic
1184131466 22:42519300-42519322 CAGGGGCAAGAGGAGAAGGAGGG + Intronic
1184141692 22:42581516-42581538 CAGGGGCAAGAGGAGAAGGAGGG + Intergenic
1184449718 22:44575775-44575797 AAGGGGAAAGAAGAGGAGGAGGG + Intergenic
1184697783 22:46149829-46149851 CGGGGGAACGAGGAGGGTGAAGG - Intergenic
1184746842 22:46461156-46461178 GAGGGAAAAGGGGAGGAAGAGGG + Intronic
1184786331 22:46673718-46673740 CTGGGTAAAGAGGAGGACGCCGG + Exonic
1184877583 22:47285260-47285282 GAGGAAAAAGAGGAGCAGGAGGG - Intergenic
1185209694 22:49563741-49563763 CAAGGAAGAGAGGGGGAGGAGGG + Intronic
949163559 3:910516-910538 AAGGGCAAAGAGGAGGTAGAAGG + Intergenic
949229375 3:1732439-1732461 AAGGGAAAACAGGAAGATGGAGG - Intergenic
949724352 3:7026083-7026105 CAGGGAAAAGAAGTGGATTGTGG + Intronic
949980588 3:9499859-9499881 GAGGAAGGAGAGGAGGATGAAGG - Exonic
950107767 3:10399070-10399092 GAGGGAAAAGGGGAGGATGCTGG - Intronic
950456964 3:13098497-13098519 GAGGGTCAAGAGGAGGGTGAGGG + Intergenic
950492600 3:13315009-13315031 CAGGGGCATGAGGAGGGTGAGGG + Intergenic
950964068 3:17134074-17134096 CAGGGAAAAGAAGCAGATGGAGG + Intergenic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
951616258 3:24548612-24548634 CATGGAGAAGAGTAGAATGAGGG - Intergenic
952002350 3:28800646-28800668 AAGGGAGAGGAGGAGGAAGAAGG - Intergenic
952221496 3:31328111-31328133 CTCGGAAAACAGGAAGATGAGGG - Intergenic
952227535 3:31394297-31394319 TATGAAAAAGAGGAGGACGAAGG - Intergenic
952418890 3:33114019-33114041 AAGGGAAAAGGGGAGGGAGAAGG - Exonic
952478727 3:33737595-33737617 CAGGGAAAAGAAGAGGGGAAAGG - Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
952964819 3:38614675-38614697 AAGAGAAAAGGGCAGGATGAGGG + Intronic
953405820 3:42659295-42659317 GAGGAAGAAGAGGAGGAGGACGG + Exonic
953637893 3:44678001-44678023 CAGGGCAATGAGGTAGATGATGG + Intergenic
953783644 3:45894283-45894305 CAGGGTAAAGAGGAGAAAGGTGG + Intronic
953856566 3:46503800-46503822 CAGGGAAAGGGGGAGGGTGCAGG - Intergenic
953871291 3:46629695-46629717 CAGGGAGAGGAGGAGAATGGAGG + Intergenic
953871319 3:46629791-46629813 GAAGGAAGAGAGGAGGAGGAGGG + Intergenic
953888486 3:46733625-46733647 CAGGGAAAAAAGGTGAGTGAAGG - Exonic
953928073 3:46992417-46992439 CAAAGAAGAGAGGAGGAAGATGG - Intronic
954198695 3:49011558-49011580 CAGGGAAGAGATGGGGATCAGGG - Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954856977 3:53652523-53652545 TAGGGAAAAGAGAAAGATCAGGG + Intronic
955125887 3:56111643-56111665 CAGGGAGAAAACGAAGATGATGG + Intronic
955143013 3:56288316-56288338 AAGGTAAAGCAGGAGGATGAGGG + Intronic
955683295 3:61525104-61525126 CAGGGAAATGAGGAAGGTGTGGG - Intergenic
955695583 3:61632798-61632820 CAGGGAGGGGAGGGGGATGAAGG - Intronic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
956058400 3:65324922-65324944 TAGGGAGAAGGGGAGGATGTGGG - Intergenic
956774030 3:72550167-72550189 AAAGGACAAGAGGAGGAGGAGGG - Intergenic
957042303 3:75345305-75345327 TAGGGAAAGGAGGAGGCTGGTGG - Intergenic
957543978 3:81613044-81613066 GAGGAAAGAGAGGAGGATGAAGG + Intronic
957640776 3:82850374-82850396 AAGAGAAAAGAAGAGGAAGAAGG - Intergenic
958953629 3:100442938-100442960 AAGAGAAAATAGGAGGAGGAAGG + Intronic
959578213 3:107957703-107957725 CAAGGAAAGGAGGAGGAGGAGGG + Intergenic
959738148 3:109685025-109685047 CAGGCAAGAGAGGGGGATGAAGG - Intergenic
959911853 3:111772407-111772429 GAAGGAAAAGAAGAGGAAGAAGG + Intronic
960029551 3:113043418-113043440 CAGGGAAGAGGGGAGAATGGTGG + Intergenic
960193935 3:114741921-114741943 CAGGGAAAATGGGAAAATGAAGG + Intronic
960196523 3:114775490-114775512 CAAGGAAAAGAGGTGGAGTAAGG - Intronic
960744992 3:120877662-120877684 AAGGAAAAAGAGGTGGAAGAGGG - Intergenic
960874529 3:122283906-122283928 CAGGGAGAAGAGGAGGAGGTAGG - Exonic
961047031 3:123716155-123716177 TAGGGAAAGGAGGAGGCTGGTGG - Intronic
961837409 3:129674505-129674527 AGGGGAAGAGAGGAGAATGATGG + Intronic
961908050 3:130283115-130283137 CAGGGAAAAGAGGAGAAACCAGG + Intergenic
961985216 3:131124574-131124596 AAGGGAGAAGAGGAGGAGAATGG + Intronic
962612108 3:137086671-137086693 CTGGGAACAGAGGCGTATGAGGG + Intergenic
962800839 3:138889255-138889277 CATGGCAAAGAGGATGAGGAAGG + Intergenic
962876997 3:139542731-139542753 CAGAGAGATGAGGAGGAGGAAGG + Intergenic
963106426 3:141651270-141651292 CTGGGAACTGGGGAGGATGAAGG + Intergenic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
964067713 3:152598554-152598576 GAGGGAAAAAAGGAGGATTTGGG - Intergenic
964209847 3:154214547-154214569 CAGGGACAAGAGCGTGATGAAGG + Intronic
964369813 3:155988141-155988163 GAGGAAGGAGAGGAGGATGAAGG + Intergenic
964398825 3:156277132-156277154 AAGGAAAAAGAGGGAGATGAGGG + Intronic
965242999 3:166227889-166227911 TAGGGATATGAGGAGGGTGATGG + Intergenic
965524525 3:169702004-169702026 AAAGGAAAAGAGGAGGAAGAAGG - Intergenic
965792704 3:172406590-172406612 AAGAGAAAAGAAGAGGATTAAGG + Intergenic
965862092 3:173160092-173160114 GAGGGAAAGGAGGAGGATTTGGG + Intergenic
966241431 3:177758750-177758772 CTGAGAAAACAGGAAGATGATGG - Intergenic
966479461 3:180389782-180389804 AAAAGAAAAGAGGAGAATGAGGG + Intergenic
966653181 3:182323883-182323905 CAGAAAAATGAAGAGGATGAGGG - Intergenic
966879036 3:184339259-184339281 CAGAGAAAAGAAGAGGCTGTCGG + Intronic
967229642 3:187325264-187325286 CAGAGAAAAGAGGGGGTGGAAGG + Intergenic
967553829 3:190831508-190831530 TAGGGAAAGGAGGGGGAAGAAGG - Intergenic
967917395 3:194588883-194588905 CAGAGAAGAGTGGAGAATGAGGG - Intronic
967937061 3:194737539-194737561 CACAGAAGAGAGGAAGATGAAGG - Intergenic
968178293 3:196569610-196569632 CGGGGAGAAAAGTAGGATGAGGG - Intronic
968181910 3:196601681-196601703 AAGGGAAAGGAGGAGGAAGCTGG - Intergenic
968268524 3:197381369-197381391 CAGTAAAAAGTGGATGATGAGGG - Intergenic
968810743 4:2798702-2798724 CAGGGCAGAGGGGAAGATGACGG + Intronic
968817195 4:2828270-2828292 CAGGGAAAATGGAAGGATCAAGG - Intronic
969139225 4:5054204-5054226 CGGGAATATGAGGAGGATGAAGG + Intronic
969321652 4:6416597-6416619 CAGGGACAAGAGGAGCCTGCAGG - Intronic
969392849 4:6902370-6902392 TAGGGATGAGAGGAGGATGGGGG + Intergenic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969648523 4:8448467-8448489 CATGGAAGAGAGGCGGATGAAGG + Intronic
969692899 4:8715435-8715457 CAGAAAATAGAGGAGGAGGAAGG - Intergenic
969727780 4:8934091-8934113 AAGAGAAAATAGGAGGAGGAAGG - Intergenic
970166394 4:13242745-13242767 CAGGGTTAGGAGGAGGATGTAGG - Intergenic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
970545726 4:17128177-17128199 CAGTGAAAAAAGGCTGATGAGGG + Intergenic
970641321 4:18069488-18069510 CAGGGAAGAGAGGTGGAGGGAGG - Intergenic
971133851 4:23844966-23844988 CAGGGAAAAGAGTAAGAGTAAGG + Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971422786 4:26489348-26489370 CAGGGAGAGGAGGAAGATGTTGG + Exonic
971454980 4:26835708-26835730 CAGGGCAAAGAATAGGGTGAAGG - Intergenic
971504922 4:27356113-27356135 GAGTGAAAAGAGGAAGATGATGG - Intergenic
971570946 4:28210010-28210032 GAGGGGAAGGAGGAGGAAGAGGG - Intergenic
971898371 4:32625624-32625646 CTTGGAAAAGAAGAGGGTGATGG + Intergenic
971961031 4:33487300-33487322 GAGGGAAAAGAGAAGAATGAGGG + Intergenic
972216541 4:36904352-36904374 GAGGAAAAGGAGGAAGATGAAGG + Intergenic
972219371 4:36936162-36936184 CAGGGGAAAGAGGCGGCTGTGGG + Intergenic
972770056 4:42189417-42189439 CAGAGAAAAGAGGATAAGGAGGG - Intergenic
973080945 4:45992360-45992382 CATGGAGAAGAGGCTGATGAGGG - Intergenic
973245318 4:48004633-48004655 AAGAGAAAATAGGAGGAGGAAGG + Intronic
973372876 4:49266186-49266208 CAAGTAAAAGAGGAGGTGGACGG + Intergenic
973388121 4:49528873-49528895 CAAGTAAAAGAGGAGGTGGACGG - Intergenic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
973709922 4:53619348-53619370 CTGGGAAAAGAAGGGAATGAGGG - Intronic
973769744 4:54195480-54195502 AATGGAAGAGAGGAGGAAGAGGG + Intronic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
974132809 4:57777457-57777479 CTGGGAAAGAAGGAGGCTGAGGG - Intergenic
974463760 4:62226042-62226064 CAAAAAAAAGAGGAGGACGAAGG - Intergenic
974820020 4:67054721-67054743 CAGGGAAGAGAGTATGATAAAGG - Intergenic
975193133 4:71489936-71489958 CAGGGAAAAGAGCAGGAGAGAGG + Intronic
975448025 4:74490466-74490488 CAGTGACAAGATGAGGCTGAAGG - Intergenic
975875731 4:78834733-78834755 GCGGAAAAAGAGGGGGATGATGG + Intronic
976428716 4:84937360-84937382 CAGGGAGAAGAGGAGGAACTAGG - Intronic
976784703 4:88804959-88804981 CAGGGAATAAAGGAGGGTTAAGG - Intronic
977789320 4:101079800-101079822 CAGGGAAAAGAAGAAGAGCAAGG - Intronic
977937271 4:102821427-102821449 CAGGGAATAAATGAGGAAGATGG - Intronic
978145799 4:105369787-105369809 AAGGGATAAGAGGAGGGAGAAGG + Intronic
978394020 4:108258648-108258670 CAGGGAAAAGAGGAACATGATGG + Intergenic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
978861776 4:113458934-113458956 AAGGAAAAAGAGAAGGATAAAGG + Intronic
979211855 4:118114240-118114262 TAGGGAAAACTGAAGGATGAAGG - Intronic
980269681 4:130567912-130567934 AAGAGAAAATAGGAGGAAGAAGG + Intergenic
980479461 4:133368883-133368905 CAGGGAGAAGTGGGGGAAGAGGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980826916 4:138084617-138084639 GAGAGAAAAGAGGCTGATGAGGG + Intergenic
981071691 4:140547255-140547277 AAAGGAAAAGAGGGAGATGAAGG - Intronic
981157070 4:141450820-141450842 CAGGACAAAGAAGAGGAGGAAGG - Intergenic
981948117 4:150373807-150373829 CAGGGAAAAGAGGAGAGGTAAGG - Intronic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
982381039 4:154747713-154747735 CAAGGAGAAAAGGAGGTTGATGG - Intronic
983426395 4:167589094-167589116 TAGAGAATAGTGGAGGATGAGGG + Intergenic
984320531 4:178190200-178190222 CAGGGAAAAGAAGGGGACGCAGG + Intergenic
984456661 4:179977686-179977708 GAGGGAGAAGAGGATGAAGAGGG - Intergenic
984567863 4:181352516-181352538 CACGGAGAAGAGGAGGACCAAGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985055261 4:186030542-186030564 CATGGAAAAGAGGAAAATGAAGG - Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985644058 5:1076816-1076838 CAGGGAGAAGGGCAGGAAGATGG + Intronic
986236847 5:5918717-5918739 AAGGAAGAAGAGGAGGAGGAAGG + Intergenic
986283831 5:6345593-6345615 CAGAGAACAGAGGAGGAGGGAGG + Intergenic
986858820 5:11903744-11903766 CAGCGGCAAGAGGAGGAGGACGG + Intronic
986928028 5:12782599-12782621 GAGGGAGAAGAAGAGGGTGAAGG + Intergenic
986979851 5:13434774-13434796 CAAGGAAAAGAGTGGGATAAGGG + Intergenic
987032876 5:13991569-13991591 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
987032882 5:13991587-13991609 GAGGGGGAAGAGGAGGAGGAAGG + Intergenic
987375927 5:17234832-17234854 CAGGCAAAAGAGGTGGATCTAGG - Intronic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
987903509 5:24046249-24046271 GGGGGAAAAGAGGAAGGTGAAGG - Intronic
988256647 5:28829366-28829388 CAAGGAAAAGAGTATGATCATGG - Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
988849522 5:35165195-35165217 CAGGGCAAAGTGGTGGTTGATGG - Intronic
989193739 5:38695674-38695696 ATGGGGAAAGAGGAGGAAGAAGG - Intergenic
989206752 5:38816761-38816783 CAGGCAAAAGAGGAGAACCAGGG - Intergenic
990609572 5:57443963-57443985 CAGAGATAAGAGCAGGCTGAGGG - Intergenic
991198541 5:63962257-63962279 AAGGGAAGTGAGGAGGAAGAGGG - Intronic
991444748 5:66687218-66687240 GAGGGAAAAGAAGGGGGTGAAGG - Intronic
991946525 5:71903058-71903080 AGGGGAAAAGGGGAGAATGAAGG + Intergenic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992024260 5:72654939-72654961 GAGGGAAAAGAGGAGGAAAATGG - Intergenic
992700201 5:79334247-79334269 CAGGAACAAGAGGAGGTTGAAGG + Intergenic
993289301 5:86043989-86044011 CTGGGAAAAAATGAGGATAAGGG - Intergenic
994458861 5:100049016-100049038 AAGGGATAGGAGGAGGATGGGGG + Intergenic
994606691 5:101976267-101976289 CAAGGTAAAGAGAAGGATAATGG + Intergenic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
994779113 5:104068687-104068709 GAGGGAAAGGAGGAGGATCTGGG + Intergenic
994848192 5:105017913-105017935 AGGGAAAATGAGGAGGATGAAGG + Intergenic
994902895 5:105799604-105799626 CATGGAAAAGAGGAAGGGGAAGG + Intergenic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
995125320 5:108572971-108572993 GAGGGAAAGGAGGAGGATTTGGG + Intergenic
995308315 5:110680971-110680993 GAGGGAAAAGAGAAGGGTGAGGG + Intronic
995369714 5:111405540-111405562 AAGGGAAAAAAGGAGTATTATGG - Intronic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995704553 5:114973955-114973977 CAGTTAAAAGAGGAGAGTGAGGG + Intergenic
995862528 5:116656787-116656809 CTAGAAAAAGATGAGGATGAGGG + Intergenic
995936812 5:117526721-117526743 CAAGGAAAAGAGAAGAAAGAAGG + Intergenic
995942691 5:117602987-117603009 AAGAGAAGAGAGGAGGAAGAAGG + Intergenic
996116461 5:119625430-119625452 CAGAAAGAAGAGGAGGAGGAGGG - Intronic
996284160 5:121769335-121769357 AAAGGAAAATAGGAAGATGAGGG + Intergenic
996354580 5:122581605-122581627 CTGGGAAAAAAAGAGGAAGAGGG + Intergenic
997265353 5:132491675-132491697 TAGGGAACAGAGGAGGAGAAGGG + Intergenic
997663386 5:135606936-135606958 CAGGGAACAGAAGAGAATTAGGG - Intergenic
997676594 5:135717627-135717649 CAGGGAAAAGTGTCGCATGATGG + Intergenic
997836094 5:137194640-137194662 CCCGGGAAAGAGGAGGATGTTGG - Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998582038 5:143386586-143386608 CAGAGAAATGTGGAGGATAAGGG + Intronic
998771935 5:145555747-145555769 CAAGAAAAAGAGAAGGATGGAGG + Intronic
998813217 5:145986888-145986910 CAGGGAAAAGGGAAGGAAGTAGG - Intronic
998874523 5:146586026-146586048 CAGGGGGAAGAGGTGGATGAAGG + Intronic
999050953 5:148523421-148523443 GAGAGAAAAGGGGAGGAAGAGGG + Intronic
999089174 5:148920582-148920604 CAGGGAAGAGAAGAGATTGAGGG + Intergenic
999258185 5:150221559-150221581 CAGGGCAGAGAGGAGGAGGGAGG - Intronic
999309360 5:150541829-150541851 GAGGGGAAAGAGGTGGAGGAGGG + Intronic
999550027 5:152676466-152676488 CAGAGAAAAGAAGGTGATGATGG + Intergenic
999904443 5:156124091-156124113 CAGGGAAAGGGGGAGGAGAAAGG - Intronic
1000290432 5:159865053-159865075 CAGAGAAAAGGGGAGGATTCGGG + Intergenic
1000379988 5:160620471-160620493 CAGGGTGCAGAGGAGGCTGAAGG + Exonic
1000489833 5:161897672-161897694 GAGAGAAAAGAGGGGGAAGATGG + Exonic
1001022461 5:168195081-168195103 GAGGGACCAGATGAGGATGAGGG + Intronic
1001087890 5:168714762-168714784 CAGGGAGAAGGGGAGGAGAAAGG - Intronic
1001150548 5:169223875-169223897 GAGGGAAAGGAGGAGGCTGCAGG + Intronic
1001265254 5:170269408-170269430 CAGGGAAAAGGGTAGGAGCAAGG + Intronic
1001716091 5:173817688-173817710 CAGGGAAGCGGGCAGGATGAAGG + Intergenic
1001893818 5:175361913-175361935 GAGGAAAAAGAGAAGGAAGAGGG + Intergenic
1002021777 5:176368227-176368249 AAGGGAAAAGAAGGGGATGGGGG + Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002366486 5:178716595-178716617 CTGGGGAAGGAGGGGGATGAAGG + Intronic
1002511761 5:179724747-179724769 AAGGGAGATGAGGAGGAGGAAGG + Exonic
1002656531 5:180753240-180753262 CAGGGAAAAGGTGAGCAAGAGGG + Intergenic
1002692785 5:181061992-181062014 AAGGGGAAAGGAGAGGATGAGGG + Intergenic
1002941442 6:1720152-1720174 CAAGGAAAAAAGGAGGAAGTTGG + Intronic
1004127391 6:12887014-12887036 CAAGGGGAAGAGGAGGAAGAGGG - Intronic
1004278498 6:14258882-14258904 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1004751596 6:18567516-18567538 GAAGGAAAGGAGGAGGAGGAAGG - Intergenic
1004920239 6:20369329-20369351 CAGGAAAAGGAGAAGGATCAGGG + Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005087624 6:22022963-22022985 TATGGAAAAGAGGAGGGGGAGGG - Intergenic
1005365787 6:25075516-25075538 GAGGGAAGAGAGGAAGATGGAGG + Intergenic
1005881716 6:30067373-30067395 CAGGGAGGAGAGGAGGAAGGGGG - Exonic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1005996828 6:30936678-30936700 AAGGGAGGGGAGGAGGATGATGG - Intergenic
1006297082 6:33174468-33174490 CAGGGAAGCGAAGAGGAGGAGGG + Intronic
1006334528 6:33413620-33413642 AAGGAAAAAGAACAGGATGAGGG + Intronic
1006524215 6:34589938-34589960 AAGAGAAAAGAGGAGGAAAAGGG + Exonic
1006870637 6:37247930-37247952 CAGGCACATGAAGAGGATGAGGG + Intronic
1006874328 6:37282239-37282261 CCGGGCAACGAGGGGGATGATGG - Exonic
1007066595 6:38997016-38997038 GAGAGAACAGAGGAGGACGAAGG - Intronic
1007554970 6:42758153-42758175 CAGGGAGAAGAAGATGAGGAAGG - Intronic
1007666317 6:43515412-43515434 GATGGAAAAGAAGAGGAAGATGG + Intronic
1008228433 6:48952576-48952598 GAGGAAAAAGAAGAGGAAGATGG + Intergenic
1009464228 6:63951442-63951464 GAGGGAAAGGAGGAGGATTTGGG - Intronic
1009482193 6:64172901-64172923 CAGGAAGAAGGGGAGGAGGATGG - Intronic
1010149985 6:72719948-72719970 CATAGAAAGGATGAGGATGAAGG - Intronic
1011113146 6:83860191-83860213 CAGGGAGAAGATGAGGTTGAGGG - Intronic
1011840907 6:91497805-91497827 GGAGGAAAAGAGGAGGAGGAGGG - Intergenic
1012121192 6:95368648-95368670 AAGGGGAAAGAAGAGGAAGAAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012944192 6:105448612-105448634 TGGGGAAATGAGGAGGATCATGG - Intergenic
1014328448 6:120028841-120028863 AAGGTATAAGAGGAAGATGAAGG + Intergenic
1014383750 6:120776701-120776723 GAGGGAAAAGAGGAGGTGAAGGG - Intergenic
1014810821 6:125883677-125883699 TAGGGGAAAGAGAAGGATGGGGG - Intronic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1015041687 6:128728158-128728180 CAGAGAAAAGAGGAGAGAGATGG - Intergenic
1015072610 6:129113840-129113862 CATGGAACAGCTGAGGATGATGG - Intronic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015626163 6:135182293-135182315 GAGGGAGAGGAGGAGGAGGAGGG + Intronic
1015898992 6:138045613-138045635 GAGGGAAAGGAGGATGAGGATGG - Intergenic
1016265771 6:142231432-142231454 TAGGCACAAGACGAGGATGAAGG - Intergenic
1016531715 6:145065689-145065711 CAGGGAAAAGAGGAGGAGTTTGG + Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017485765 6:154900714-154900736 CAAGGAAAGGAGGGGGAAGATGG + Intronic
1017786808 6:157763252-157763274 CAGGGAAAAGGGGAGGGCGGCGG + Intronic
1018256653 6:161926619-161926641 CAGGGATAAGACGAACATGAAGG - Intronic
1018341885 6:162859543-162859565 CAGGGGAGAAAGGAAGATGAAGG - Intronic
1018415943 6:163602133-163602155 GAGGACAAAGAGGAGGAAGAGGG + Intergenic
1018611764 6:165654254-165654276 CAGGACAATGAGGAGGATGACGG - Intronic
1018681620 6:166270192-166270214 CAGGGAGGACAGGAGGATGGAGG + Intergenic
1018723004 6:166588173-166588195 CAGGGAGCAGTGGAGGGTGAGGG - Intronic
1018742683 6:166742614-166742636 CAGGAATGAGAGGCGGATGAAGG - Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1019557722 7:1641005-1641027 CTGGGAAGAGAGGAGGTGGAGGG - Intergenic
1019747373 7:2708491-2708513 CAGGCAGAGGAAGAGGATGACGG + Intronic
1020080034 7:5282229-5282251 GGGAGAAAAGAGGAGGATGGAGG + Intronic
1020080210 7:5282774-5282796 GAGGGAGGAGAGGAGGGTGAAGG + Intronic
1021475883 7:21060070-21060092 CAGGGAAAAGATTAGGATATGGG + Intergenic
1021479461 7:21100096-21100118 CAGGGGAAAGAGTAGGATTGTGG - Intergenic
1021527294 7:21603027-21603049 CAGGGCATGGAGGAGGATAATGG - Intronic
1021588542 7:22236555-22236577 CAGGGGAAGGAGGACCATGAAGG - Intronic
1021601050 7:22363738-22363760 CAGGGAATAGAGGAGTAGCAGGG + Intergenic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1021840763 7:24719921-24719943 CAGGGAATACAGGATTATGATGG + Intronic
1021924218 7:25519295-25519317 CAGGGAAAAGAGGGAGAGCAGGG + Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022491473 7:30823423-30823445 CAAGGAAAAGAGAAAGAAGATGG - Intronic
1022624414 7:32019935-32019957 CAGGGAAAAGAGCAAGCTGGAGG + Intronic
1022758054 7:33315604-33315626 AAGAGAAATGGGGAGGATGAAGG + Intronic
1023122796 7:36926159-36926181 CAAGGCAAAGAGGTGGAGGAAGG + Intronic
1023284853 7:38608435-38608457 CAGTGAAAAAAGGTGGAAGAAGG - Intronic
1023863124 7:44227164-44227186 CAGGGGACAGAGGAGGGTGCAGG + Intronic
1023863130 7:44227183-44227205 CAGGGGACAGAGGAGGGTGCAGG + Intronic
1023863138 7:44227202-44227224 CAGGGGACAGAGGGGGATGTGGG + Intronic
1024545312 7:50512794-50512816 AAGGGAAAAGAGGAAAATAAGGG - Intronic
1024627497 7:51220496-51220518 CAGGGAAAGGATGCGGGTGATGG + Intronic
1024644291 7:51358267-51358289 CTGGTAAAAGGGGAAGATGAGGG - Intergenic
1024770284 7:52714105-52714127 TAGATAAAGGAGGAGGATGAAGG - Intergenic
1024883100 7:54111807-54111829 CAGGGAAAAGGGAAGGAAAAGGG + Intergenic
1024974194 7:55098173-55098195 CAGGGAAAAAATGAGGGTGTTGG + Intronic
1025035270 7:55589713-55589735 CACAGAAAAGAGAAGGGTGAGGG - Intergenic
1025198707 7:56949423-56949445 GAGGGAGGAGAGGAGGGTGAAGG - Intergenic
1025198730 7:56949510-56949532 GAGGGAGAAGAGGAGGGAGAGGG - Intergenic
1025198882 7:56949987-56950009 GGGAGAAAAGAGGAGGATGGAGG - Intergenic
1025673064 7:63626946-63626968 GGGAGAAAAGAGGAGGATGGAGG + Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026191930 7:68136553-68136575 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
1026297958 7:69072298-69072320 GAGCCAAAAGAGGAGGAAGAAGG + Intergenic
1026379010 7:69780526-69780548 TAGGGCAAAGAGGAGGAGGGCGG + Intronic
1026509341 7:71015562-71015584 AAAGGAAGACAGGAGGATGAAGG + Intergenic
1026638625 7:72105750-72105772 CAGGGAGAAGAGGAAGAAGAAGG + Intronic
1026849132 7:73714060-73714082 ATGGGAGAAGAGGAGGAAGATGG - Intronic
1027020883 7:74813401-74813423 AAGGAAGGAGAGGAGGATGAAGG + Intronic
1027067142 7:75132525-75132547 AAGGAAGGAGAGGAGGATGAAGG - Intronic
1027823752 7:83084013-83084035 CAGAGGAAAGATGAAGATGAAGG + Intronic
1028418007 7:90599621-90599643 CAATGAAGAAAGGAGGATGATGG - Intronic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028741684 7:94282481-94282503 CAAGGAAATGAGGAGCATGTGGG - Intergenic
1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG + Exonic
1028776500 7:94683380-94683402 TTTGGAAAAGAGGAGGATGTAGG - Intergenic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1028872386 7:95783691-95783713 AAAACAAAAGAGGAGGATGAAGG - Intronic
1029090014 7:98040694-98040716 CAAGGAAAGGAGGATGATGGAGG + Intergenic
1029412850 7:100426865-100426887 CAGGGAAGGGAGGAGGGGGAGGG - Intronic
1029552929 7:101247571-101247593 CAGGGGACACAGGAAGATGAAGG + Intronic
1029644550 7:101845546-101845568 GAGGGAATAGAGGAGGAGGCTGG + Intronic
1029995135 7:105000530-105000552 GATGGAAAAAAGGAGGAGGATGG + Intergenic
1030047197 7:105508250-105508272 GAGGAAGAAGAGGAGGAAGATGG - Exonic
1030290281 7:107865282-107865304 GGAGGAAAAGAGGAGGCTGATGG - Intergenic
1030304502 7:108004328-108004350 GAGGGAAAAGAGGTTGGTGACGG + Intergenic
1030473911 7:110003582-110003604 GAAGGGAAGGAGGAGGATGAAGG + Intergenic
1031380256 7:121077006-121077028 AAGGGCAAAGAGGAGGATACAGG - Intronic
1031981662 7:128130913-128130935 CAGGGAGAAAAGGAGGAAGGAGG - Intergenic
1032170305 7:129578903-129578925 CAGGGAAGCGAGGTGGTTGAAGG + Intergenic
1032246799 7:130220230-130220252 CAGGGCACACTGGAGGATGAGGG - Intergenic
1032439760 7:131933401-131933423 GAGGAAAAAGAGGAAGAAGAAGG + Intergenic
1032869959 7:135974540-135974562 CAAAAAAAAGAGGAGGAGGAGGG + Intronic
1033015964 7:137672054-137672076 CAGGGAACAGAGTAGGTAGATGG - Intronic
1033046487 7:137967098-137967120 CAGGGCAAAGAGGAGTGGGAAGG - Intronic
1033463169 7:141565680-141565702 CAGGGAATGAAGGAGGATAAAGG - Intronic
1033665147 7:143433980-143434002 CAGGGAAAGGTGGAGGAAAAAGG - Intergenic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1035158082 7:156930336-156930358 CTGGGAGAAGGGGAGGAAGACGG - Intergenic
1035287724 7:157816860-157816882 AAGAGAAAAGAGGAGGAGAAAGG - Intronic
1035476146 7:159145183-159145205 CAGGGAAGAGGGGAGGAGAACGG - Intergenic
1035517795 8:251268-251290 CAGGGAATAGTGGTGGAGGAGGG + Intergenic
1036155390 8:6337459-6337481 CAGGAATAGGAGCAGGATGAAGG - Intergenic
1036607012 8:10316574-10316596 GGGGGAGAAGAGGAGGAGGAAGG - Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036746959 8:11416739-11416761 CAGGCAGAAGAGGAGGAAGTTGG - Intronic
1037213820 8:16424947-16424969 GAGGAAGAAGAGGAGGAGGAAGG - Intronic
1037622079 8:20573089-20573111 CAGGGAGCAGAGGAGGAAGCAGG - Intergenic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1038056032 8:23858523-23858545 AAGGAAAATGAGGAAGATGAGGG + Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1039628970 8:39088075-39088097 CAGGAAGATGATGAGGATGAAGG - Intronic
1039790338 8:40870860-40870882 CAGGCTAAAGAAGAGGATGCTGG + Intronic
1039884077 8:41645657-41645679 CGGGGAAAAGGGGAGGGTGCAGG - Exonic
1040071969 8:43195764-43195786 GAGGAAGAAGAGGAGGAGGAGGG + Intronic
1041617521 8:59925271-59925293 GAGAGAGAAGAGGAGAATGAGGG + Intergenic
1041645069 8:60243276-60243298 CCTGGAAAAGAGGAGGAGGGAGG - Intronic
1041691395 8:60691486-60691508 CAGTGAGAAAAGGAGGATGGGGG - Intronic
1041779205 8:61558906-61558928 GAGGAAGAGGAGGAGGATGAGGG - Intronic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1043045289 8:75315303-75315325 CAGGGGAAAGAGGAGAGTTATGG + Intergenic
1043185030 8:77137810-77137832 CAAGGCAAAGAGCAGCATGAAGG - Intergenic
1043386432 8:79752561-79752583 GAGGAAAAGGAGGAGGAAGAAGG + Intergenic
1043602036 8:81952521-81952543 GAGGGAAGAAGGGAGGATGATGG - Intergenic
1043994180 8:86792228-86792250 CAAGGAATAGAAGAGAATGATGG + Intergenic
1044769366 8:95613888-95613910 CAGGGAAAAGGGCAGGAAGGGGG - Intergenic
1044923138 8:97186714-97186736 CAGGGAACAGAGAAGTACGAAGG + Intergenic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045267674 8:100634126-100634148 CACGGAAAAGAGGATGTTGAGGG - Intronic
1045330199 8:101149234-101149256 CAGGGAGAAGGGGAGATTGATGG + Intergenic
1045503048 8:102757955-102757977 CAGGTAAGAGAGGAGGGAGAGGG + Intergenic
1046058898 8:109112527-109112549 CAGGAAATAGATGAGTATGAAGG + Intronic
1046867947 8:119171758-119171780 AAGGTAAAAGAGGAGGCTGTTGG + Intronic
1047428305 8:124766859-124766881 GAGAGCAAAGAGGAGGATGCTGG + Intergenic
1047476997 8:125242228-125242250 GAGAGAAAAGAGGAAGCTGATGG + Intronic
1047601977 8:126434724-126434746 CAGTTAAAAGAGGAAGAGGAAGG + Intergenic
1048047970 8:130791239-130791261 CAGGGAAAAGGGGAGAATGCTGG + Intronic
1048227994 8:132608999-132609021 GAGGAAAAAGAGTAGAATGAGGG - Intronic
1048533297 8:135270425-135270447 CTGGGAAAAGAGAAGGTTGGAGG + Intergenic
1048557919 8:135499088-135499110 CAGGTAAAAGAGGTGGAACATGG + Intronic
1048582950 8:135745506-135745528 CAGGGAAAGATGGAGGATTAGGG + Intergenic
1048864044 8:138746258-138746280 AAGGGAAGAGACGAGGCTGACGG - Intronic
1049023107 8:139971049-139971071 CAGAGAAAAGAGGTGGATTCCGG - Intronic
1049343945 8:142128579-142128601 CTGGGAAAAGAGCAGGAGGGTGG + Intergenic
1049984997 9:942050-942072 CAGAGAATAAAGGAAGATGATGG - Intronic
1050305419 9:4300561-4300583 CAGGGAAGAGAGGAAGGTGATGG + Intronic
1050424345 9:5498600-5498622 GGGGGAAGAGAGGAGGAGGAGGG - Intergenic
1051000739 9:12279139-12279161 TAGGGTAAAGAGGAGGAGTAAGG - Intergenic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051226510 9:14904944-14904966 CAGGTAAATGAGGTGGTTGATGG - Intronic
1051345183 9:16144971-16144993 CAGTGAAAGGAGGAGGCTGATGG - Intergenic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052145993 9:25050135-25050157 AAGGAAAGAGAGGAGAATGAAGG + Intergenic
1052918204 9:33940000-33940022 GAGGGGAAAGAGGAGGGGGAGGG + Intronic
1053225859 9:36356347-36356369 GTGGCAAATGAGGAGGATGATGG + Exonic
1053361895 9:37493972-37493994 CAGGGCACAGAGGAGGGAGAAGG + Intronic
1053446511 9:38157243-38157265 CAGGAAAGAGATGAGGATGGCGG - Intergenic
1053561314 9:39198294-39198316 CTGAGAACAGAGGAGGTTGAGGG - Intronic
1053655607 9:40215785-40215807 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1053825410 9:42018532-42018554 CTGAGAACAGAGGAGGCTGAGGG - Intronic
1053905970 9:42845001-42845023 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1054135805 9:61420653-61420675 CTGAGAACAGAGGAGGTTGAGGG + Intergenic
1054367725 9:64362015-64362037 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1054528999 9:66160507-66160529 CAAGTAAAAGAGGAGGTGGATGG + Intergenic
1054605153 9:67168825-67168847 CTGAGAACAGAGGAGGCTGAGGG + Intergenic
1054675342 9:67851750-67851772 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG + Intronic
1054745771 9:68852616-68852638 CAGGGCACAGAGCAGGGTGAAGG + Intronic
1054752551 9:68922606-68922628 AAGGGAAAGGAGGTGGATGAAGG - Intronic
1054877646 9:70113227-70113249 CAGGGAAGAGAGGAGGGAGGAGG + Intronic
1054890619 9:70247010-70247032 CAGGGCATAGAGCAGGTTGAGGG + Intergenic
1054901158 9:70370779-70370801 GAGGGGAAAGGGGAGGAGGAGGG + Intergenic
1055324753 9:75117868-75117890 GAGGGTCAAGAGGAGAATGAAGG - Intronic
1055524023 9:77111719-77111741 CAGGGGAAAGAGGAAAATGGAGG - Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055760219 9:79599089-79599111 CAGTGCCAAGAGGAGGATGGAGG + Intronic
1055928598 9:81536474-81536496 GAGGGCATAGAGGAGGAAGAGGG + Intergenic
1056487459 9:87073149-87073171 CAGGGAAGTGAGGGGGATCATGG + Intergenic
1056597669 9:88021016-88021038 GAAGGAAAAGAGGAAGAAGAAGG - Intergenic
1056955293 9:91076234-91076256 CAAGGAAAAGAGCAGAATCAAGG + Intergenic
1057189370 9:93077909-93077931 CATGGACATGAGCAGGATGATGG - Exonic
1057307544 9:93920990-93921012 CTGGGAAAAGTGGGGGCTGAAGG - Intergenic
1057412028 9:94825288-94825310 CAGGCAAAACAGCAGGATGCGGG - Intronic
1057572711 9:96216535-96216557 CAGGGAAAAGAAGAAGAGCACGG + Intergenic
1057936781 9:99246668-99246690 CAGGAAAAAGAGGAAGAGGTTGG + Intergenic
1058557003 9:106179932-106179954 GAGGAAAAAAAGGAGGATGAGGG - Intergenic
1059038337 9:110784865-110784887 AAGGAAGAAGAGGAGGAGGAAGG - Exonic
1059054082 9:110960442-110960464 CTGGGCAAAGAGGAGGCTAATGG + Intronic
1059544558 9:115163338-115163360 AATGGAAAAGAGTAAGATGATGG + Intronic
1059578595 9:115519199-115519221 GAGAGAAATGAGGAGGAAGAAGG - Intergenic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059751932 9:117255778-117255800 CAGGGAGGGGAGGAGGAAGAAGG + Intronic
1059768261 9:117403940-117403962 GAGGCATAAGAGGAGCATGAGGG + Intronic
1060055916 9:120412898-120412920 CAGGGGAGAGTGGAGGAAGATGG - Intronic
1060489569 9:124072607-124072629 CAGGAGACAGAGGAAGATGAAGG - Intergenic
1060626342 9:125115796-125115818 CATAGAAAAGAGGAATATGAGGG + Intronic
1060943763 9:127558047-127558069 CCAGGAAAAGAGGAGGGGGAAGG - Intronic
1061100156 9:128486011-128486033 GAAGGAAAAAAGGAGAATGATGG - Intronic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1061279459 9:129588900-129588922 AAGGGAAAAAAGGTGGATTAAGG + Intergenic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1061956135 9:133962157-133962179 CTGGGCACAGAGGGGGATGAAGG + Intronic
1062074738 9:134579769-134579791 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074755 9:134579811-134579833 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074773 9:134579854-134579876 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062163910 9:135096144-135096166 GAGGAGGAAGAGGAGGATGAAGG - Intronic
1062190777 9:135246841-135246863 CATGCAAGAGAGGAGGAAGAGGG + Intergenic
1062425965 9:136506403-136506425 CAGGGTGAGGAGGAGGATGAAGG + Intronic
1062478726 9:136741939-136741961 CAGGGACAAGAGGAAGCTGGGGG - Exonic
1062590335 9:137271799-137271821 CAGGGACAGGAGGAGGGTGGAGG - Intronic
1062633866 9:137479655-137479677 CAGGGAGCAGAGGAGGGAGACGG + Intronic
1062727037 9:138080255-138080277 CTGGGGACAGAGGAGGGTGAGGG + Intronic
1203696590 Un_GL000214v1:104212-104234 CAAGTAAAAGAGGAGGTGGACGG + Intergenic
1203552630 Un_KI270743v1:176816-176838 CAAGTAAAAGAGGAGGTGGACGG - Intergenic
1185499177 X:584471-584493 CAGGAAGAAGAGGAGGAAAAAGG + Intergenic
1185499183 X:584483-584505 GAGGAAAAAGGGGAGGAGGAGGG + Intergenic
1185545400 X:939789-939811 AAGAGAAAAGAGGAGGAGGGGGG - Intergenic
1185839491 X:3375420-3375442 CAGGGCAAAGAGGAAGGAGAAGG + Intergenic
1186093488 X:6074999-6075021 TAGGGAAAAAAGGATGATAAAGG + Intronic
1186366851 X:8904537-8904559 GAAGGAAAAGAGGAGGAGGTTGG - Intergenic
1186731576 X:12416185-12416207 AAGGGAAGAAAGGAGGAGGAAGG - Intronic
1187046592 X:15653494-15653516 GAGGAAAAAGAGGAGGAAGAAGG - Intronic
1188201118 X:27293679-27293701 CAGGGAAAGAAGGAGGATTTGGG + Intergenic
1188558343 X:31438086-31438108 AAGGGAAACGTGGAGGATGAAGG - Intronic
1188890933 X:35610622-35610644 GAGGGAAAGGAGGAGGATTTGGG - Intergenic
1189649655 X:43175841-43175863 AAGGGAAAAGAGAAAGAAGAGGG + Intergenic
1189748412 X:44193885-44193907 GTAGGAAAAGAAGAGGATGAGGG + Intronic
1189882940 X:45510927-45510949 GAGGGAAAAGGGGAGAAGGAGGG - Intergenic
1189996967 X:46648098-46648120 CAGGGAAAAGGGGGGCATGTGGG + Intronic
1190454201 X:50610166-50610188 GAGGGATAAGAGGAGAATTAAGG - Intronic
1190914704 X:54802743-54802765 CAGAGAACAGGGGAGAATGAGGG + Intergenic
1191731212 X:64337624-64337646 CAGGGCAAAAAGAAAGATGAGGG + Intronic
1191899393 X:66025086-66025108 CAAGGAGATGATGAGGATGATGG + Exonic
1192169014 X:68843057-68843079 CAGAGGAAAGAGGAAGAAGAAGG + Intergenic
1192264057 X:69526641-69526663 CAAGGAAAAGAGAATAATGAGGG + Intronic
1192664689 X:73077609-73077631 CAGGGAAAAGGACAGGAAGAGGG + Exonic
1193005397 X:76612797-76612819 AAGGGTAAAGGGGAGGAAGACGG + Intergenic
1193039144 X:76986564-76986586 GAGAGAAAAGAGGAAGAGGAGGG - Intergenic
1193223196 X:78951647-78951669 CAGGTAAAAAAGGAATATGATGG + Intronic
1194173064 X:90612570-90612592 CAGTGAAAAGGGGAGGAAGTAGG - Intergenic
1194655108 X:96563571-96563593 GAGGGAAAAGTGGAGGAGTAGGG + Intergenic
1194770565 X:97899015-97899037 CAGGAATTAGAGGAGAATGAAGG + Intergenic
1195613547 X:106895169-106895191 CAGGGGTGAGAGGGGGATGAGGG - Intronic
1195664466 X:107416356-107416378 ATGGCAAAAGAGGGGGATGAGGG + Intergenic
1195933269 X:110101026-110101048 GAGGAAAAAGAAGAAGATGAGGG - Intronic
1196130134 X:112146590-112146612 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196130138 X:112146609-112146631 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196388469 X:115185636-115185658 CAGAGAAAAGATGGGGAGGAGGG - Intronic
1196545901 X:116963644-116963666 GAGGAAGGAGAGGAGGATGAAGG + Intergenic
1196717190 X:118823456-118823478 TAGGGAAAAGACGGGGAAGAGGG - Intergenic
1196899204 X:120366657-120366679 GAGGAAAAGGAGGAGGAAGAGGG + Exonic
1197236691 X:124073901-124073923 TAGGGAAAATGGGAGGATAATGG - Intronic
1197734826 X:129843176-129843198 CAGGGAAACGAGAAGGTAGAAGG + Intronic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1198122237 X:133605675-133605697 AGAGGAAAAGAGGAGGAAGAGGG + Intronic
1199151135 X:144488448-144488470 CATGGCAAAGTGGAGGATAAAGG - Intergenic
1199527909 X:148812617-148812639 GAGGGAAAAAAGGGGGATCAGGG - Intronic
1200366055 X:155665752-155665774 CAGTGAGAAGTGGGGGATGAAGG + Intronic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1201236321 Y:11915443-11915465 CAGGGCAAAGAGGAAGGAGAAGG - Intergenic
1201453008 Y:14136324-14136346 AAGGGAAAAGAGAAGGAAAATGG - Intergenic
1201701079 Y:16882896-16882918 GAGGGAAAAAAGGAGAAGGAAGG + Intergenic
1202070737 Y:20989449-20989471 CTGGGAAAAGAGGAGAAATAAGG - Intergenic