ID: 907913297

View in Genome Browser
Species Human (GRCh38)
Location 1:58846101-58846123
Sequence CAGAGGAAACAGCATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907913297_907913305 26 Left 907913297 1:58846101-58846123 CCTTCCCCATGCTGTTTCCTCTG No data
Right 907913305 1:58846150-58846172 CTCTGCTCAGCAAACCCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907913297 Original CRISPR CAGAGGAAACAGCATGGGGA AGG (reversed) Intergenic
No off target data available for this crispr