ID: 907915944

View in Genome Browser
Species Human (GRCh38)
Location 1:58870202-58870224
Sequence CACGCACTAGGATTTTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907915944_907915948 27 Left 907915944 1:58870202-58870224 CCTTGCTAAAATCCTAGTGCGTG No data
Right 907915948 1:58870252-58870274 TCTCCCATGTTTTAGATGACTGG No data
907915944_907915949 28 Left 907915944 1:58870202-58870224 CCTTGCTAAAATCCTAGTGCGTG No data
Right 907915949 1:58870253-58870275 CTCCCATGTTTTAGATGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907915944 Original CRISPR CACGCACTAGGATTTTAGCA AGG (reversed) Intergenic
No off target data available for this crispr