ID: 907917245

View in Genome Browser
Species Human (GRCh38)
Location 1:58882371-58882393
Sequence ACGGTTATGGAAGGTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907917240_907917245 -10 Left 907917240 1:58882358-58882380 CCAAGCTTGGCACACGGTTATGG No data
Right 907917245 1:58882371-58882393 ACGGTTATGGAAGGTGTGGTGGG No data
907917237_907917245 2 Left 907917237 1:58882346-58882368 CCAGCATCTAGCCCAAGCTTGGC No data
Right 907917245 1:58882371-58882393 ACGGTTATGGAAGGTGTGGTGGG No data
907917239_907917245 -9 Left 907917239 1:58882357-58882379 CCCAAGCTTGGCACACGGTTATG No data
Right 907917245 1:58882371-58882393 ACGGTTATGGAAGGTGTGGTGGG No data
907917235_907917245 5 Left 907917235 1:58882343-58882365 CCACCAGCATCTAGCCCAAGCTT No data
Right 907917245 1:58882371-58882393 ACGGTTATGGAAGGTGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907917245 Original CRISPR ACGGTTATGGAAGGTGTGGT GGG Intergenic
No off target data available for this crispr