ID: 907918943

View in Genome Browser
Species Human (GRCh38)
Location 1:58895472-58895494
Sequence CAGCTGTAGGGAAGAACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907918935_907918943 19 Left 907918935 1:58895430-58895452 CCCCTTAGGAATATAAGCAGACT No data
Right 907918943 1:58895472-58895494 CAGCTGTAGGGAAGAACAGGAGG No data
907918936_907918943 18 Left 907918936 1:58895431-58895453 CCCTTAGGAATATAAGCAGACTG No data
Right 907918943 1:58895472-58895494 CAGCTGTAGGGAAGAACAGGAGG No data
907918937_907918943 17 Left 907918937 1:58895432-58895454 CCTTAGGAATATAAGCAGACTGT No data
Right 907918943 1:58895472-58895494 CAGCTGTAGGGAAGAACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907918943 Original CRISPR CAGCTGTAGGGAAGAACAGG AGG Intergenic
No off target data available for this crispr