ID: 907920047

View in Genome Browser
Species Human (GRCh38)
Location 1:58903746-58903768
Sequence CCGCGGGAGGAGCGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907920022_907920047 26 Left 907920022 1:58903697-58903719 CCACGTCCCGCCCGCCGCCCGGC No data
Right 907920047 1:58903746-58903768 CCGCGGGAGGAGCGGGTGGAGGG No data
907920023_907920047 20 Left 907920023 1:58903703-58903725 CCCGCCCGCCGCCCGGCTTCCCG No data
Right 907920047 1:58903746-58903768 CCGCGGGAGGAGCGGGTGGAGGG No data
907920024_907920047 19 Left 907920024 1:58903704-58903726 CCGCCCGCCGCCCGGCTTCCCGC No data
Right 907920047 1:58903746-58903768 CCGCGGGAGGAGCGGGTGGAGGG No data
907920034_907920047 0 Left 907920034 1:58903723-58903745 CCGCCCATGGGCCTCGGCAGTGC No data
Right 907920047 1:58903746-58903768 CCGCGGGAGGAGCGGGTGGAGGG No data
907920031_907920047 8 Left 907920031 1:58903715-58903737 CCGGCTTCCCGCCCATGGGCCTC No data
Right 907920047 1:58903746-58903768 CCGCGGGAGGAGCGGGTGGAGGG No data
907920033_907920047 1 Left 907920033 1:58903722-58903744 CCCGCCCATGGGCCTCGGCAGTG No data
Right 907920047 1:58903746-58903768 CCGCGGGAGGAGCGGGTGGAGGG No data
907920026_907920047 15 Left 907920026 1:58903708-58903730 CCGCCGCCCGGCTTCCCGCCCAT No data
Right 907920047 1:58903746-58903768 CCGCGGGAGGAGCGGGTGGAGGG No data
907920025_907920047 16 Left 907920025 1:58903707-58903729 CCCGCCGCCCGGCTTCCCGCCCA No data
Right 907920047 1:58903746-58903768 CCGCGGGAGGAGCGGGTGGAGGG No data
907920036_907920047 -4 Left 907920036 1:58903727-58903749 CCATGGGCCTCGGCAGTGCCCGC No data
Right 907920047 1:58903746-58903768 CCGCGGGAGGAGCGGGTGGAGGG No data
907920028_907920047 12 Left 907920028 1:58903711-58903733 CCGCCCGGCTTCCCGCCCATGGG No data
Right 907920047 1:58903746-58903768 CCGCGGGAGGAGCGGGTGGAGGG No data
907920035_907920047 -3 Left 907920035 1:58903726-58903748 CCCATGGGCCTCGGCAGTGCCCG No data
Right 907920047 1:58903746-58903768 CCGCGGGAGGAGCGGGTGGAGGG No data
907920030_907920047 9 Left 907920030 1:58903714-58903736 CCCGGCTTCCCGCCCATGGGCCT No data
Right 907920047 1:58903746-58903768 CCGCGGGAGGAGCGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907920047 Original CRISPR CCGCGGGAGGAGCGGGTGGA GGG Intergenic
No off target data available for this crispr