ID: 907922844

View in Genome Browser
Species Human (GRCh38)
Location 1:58929522-58929544
Sequence GAGAGCATAAGGAGGGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907922844_907922858 28 Left 907922844 1:58929522-58929544 CCCTCCGCCCTCCTTATGCTCTC No data
Right 907922858 1:58929573-58929595 GGTACATGAGTAGTCAAAGCTGG No data
907922844_907922859 29 Left 907922844 1:58929522-58929544 CCCTCCGCCCTCCTTATGCTCTC No data
Right 907922859 1:58929574-58929596 GTACATGAGTAGTCAAAGCTGGG No data
907922844_907922850 7 Left 907922844 1:58929522-58929544 CCCTCCGCCCTCCTTATGCTCTC No data
Right 907922850 1:58929552-58929574 TGCCATTCTCCCTCCCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907922844 Original CRISPR GAGAGCATAAGGAGGGCGGA GGG (reversed) Intergenic
No off target data available for this crispr