ID: 907925708

View in Genome Browser
Species Human (GRCh38)
Location 1:58953529-58953551
Sequence TCTTCCATGCACATGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907925708_907925714 17 Left 907925708 1:58953529-58953551 CCTTGCACCATGTGCATGGAAGA No data
Right 907925714 1:58953569-58953591 TGTGAAAGCACCCAGGAGGGAGG No data
907925708_907925710 10 Left 907925708 1:58953529-58953551 CCTTGCACCATGTGCATGGAAGA No data
Right 907925710 1:58953562-58953584 GTCAACCTGTGAAAGCACCCAGG No data
907925708_907925711 13 Left 907925708 1:58953529-58953551 CCTTGCACCATGTGCATGGAAGA No data
Right 907925711 1:58953565-58953587 AACCTGTGAAAGCACCCAGGAGG No data
907925708_907925712 14 Left 907925708 1:58953529-58953551 CCTTGCACCATGTGCATGGAAGA No data
Right 907925712 1:58953566-58953588 ACCTGTGAAAGCACCCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907925708 Original CRISPR TCTTCCATGCACATGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr