ID: 907926004

View in Genome Browser
Species Human (GRCh38)
Location 1:58955802-58955824
Sequence GGTTGCATCCTCATTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907926004_907926009 27 Left 907926004 1:58955802-58955824 CCAGAAACAATGAGGATGCAACC No data
Right 907926009 1:58955852-58955874 CACTTGCTCGCTACCTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907926004 Original CRISPR GGTTGCATCCTCATTGTTTC TGG (reversed) Intergenic