ID: 907926006

View in Genome Browser
Species Human (GRCh38)
Location 1:58955824-58955846
Sequence TAATGGGTAAGTCTATCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907926006_907926015 21 Left 907926006 1:58955824-58955846 CCAGCAGATAGACTTACCCATTA No data
Right 907926015 1:58955868-58955890 AAACTGGAAGTCAGGTGGGAGGG No data
907926006_907926009 5 Left 907926006 1:58955824-58955846 CCAGCAGATAGACTTACCCATTA No data
Right 907926009 1:58955852-58955874 CACTTGCTCGCTACCTAAACTGG No data
907926006_907926014 20 Left 907926006 1:58955824-58955846 CCAGCAGATAGACTTACCCATTA No data
Right 907926014 1:58955867-58955889 TAAACTGGAAGTCAGGTGGGAGG No data
907926006_907926017 23 Left 907926006 1:58955824-58955846 CCAGCAGATAGACTTACCCATTA No data
Right 907926017 1:58955870-58955892 ACTGGAAGTCAGGTGGGAGGGGG No data
907926006_907926011 16 Left 907926006 1:58955824-58955846 CCAGCAGATAGACTTACCCATTA No data
Right 907926011 1:58955863-58955885 TACCTAAACTGGAAGTCAGGTGG No data
907926006_907926010 13 Left 907926006 1:58955824-58955846 CCAGCAGATAGACTTACCCATTA No data
Right 907926010 1:58955860-58955882 CGCTACCTAAACTGGAAGTCAGG No data
907926006_907926012 17 Left 907926006 1:58955824-58955846 CCAGCAGATAGACTTACCCATTA No data
Right 907926012 1:58955864-58955886 ACCTAAACTGGAAGTCAGGTGGG No data
907926006_907926016 22 Left 907926006 1:58955824-58955846 CCAGCAGATAGACTTACCCATTA No data
Right 907926016 1:58955869-58955891 AACTGGAAGTCAGGTGGGAGGGG No data
907926006_907926018 24 Left 907926006 1:58955824-58955846 CCAGCAGATAGACTTACCCATTA No data
Right 907926018 1:58955871-58955893 CTGGAAGTCAGGTGGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907926006 Original CRISPR TAATGGGTAAGTCTATCTGC TGG (reversed) Intergenic