ID: 907926009

View in Genome Browser
Species Human (GRCh38)
Location 1:58955852-58955874
Sequence CACTTGCTCGCTACCTAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907926005_907926009 6 Left 907926005 1:58955823-58955845 CCCAGCAGATAGACTTACCCATT No data
Right 907926009 1:58955852-58955874 CACTTGCTCGCTACCTAAACTGG No data
907926004_907926009 27 Left 907926004 1:58955802-58955824 CCAGAAACAATGAGGATGCAACC No data
Right 907926009 1:58955852-58955874 CACTTGCTCGCTACCTAAACTGG No data
907926006_907926009 5 Left 907926006 1:58955824-58955846 CCAGCAGATAGACTTACCCATTA No data
Right 907926009 1:58955852-58955874 CACTTGCTCGCTACCTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907926009 Original CRISPR CACTTGCTCGCTACCTAAAC TGG Intergenic
No off target data available for this crispr