ID: 907928363

View in Genome Browser
Species Human (GRCh38)
Location 1:58975680-58975702
Sequence GGGGTCTTTGGGAGGTAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907928363_907928373 7 Left 907928363 1:58975680-58975702 CCTAACTACCTCCCAAAGACCCC No data
Right 907928373 1:58975710-58975732 GATACCATTACCTTGGAGTTAGG No data
907928363_907928378 30 Left 907928363 1:58975680-58975702 CCTAACTACCTCCCAAAGACCCC No data
Right 907928378 1:58975733-58975755 TTTTAACACATGGATTTTGGAGG No data
907928363_907928376 20 Left 907928363 1:58975680-58975702 CCTAACTACCTCCCAAAGACCCC No data
Right 907928376 1:58975723-58975745 TGGAGTTAGGTTTTAACACATGG No data
907928363_907928377 27 Left 907928363 1:58975680-58975702 CCTAACTACCTCCCAAAGACCCC No data
Right 907928377 1:58975730-58975752 AGGTTTTAACACATGGATTTTGG No data
907928363_907928370 0 Left 907928363 1:58975680-58975702 CCTAACTACCTCCCAAAGACCCC No data
Right 907928370 1:58975703-58975725 ACCTCCTGATACCATTACCTTGG 0: 4
1: 25
2: 243
3: 803
4: 1963

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907928363 Original CRISPR GGGGTCTTTGGGAGGTAGTT AGG (reversed) Intergenic
No off target data available for this crispr