ID: 907928364

View in Genome Browser
Species Human (GRCh38)
Location 1:58975688-58975710
Sequence CAGGAGGTGGGGTCTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907928364_907928370 -8 Left 907928364 1:58975688-58975710 CCTCCCAAAGACCCCACCTCCTG No data
Right 907928370 1:58975703-58975725 ACCTCCTGATACCATTACCTTGG 0: 4
1: 25
2: 243
3: 803
4: 1963
907928364_907928378 22 Left 907928364 1:58975688-58975710 CCTCCCAAAGACCCCACCTCCTG No data
Right 907928378 1:58975733-58975755 TTTTAACACATGGATTTTGGAGG No data
907928364_907928373 -1 Left 907928364 1:58975688-58975710 CCTCCCAAAGACCCCACCTCCTG No data
Right 907928373 1:58975710-58975732 GATACCATTACCTTGGAGTTAGG No data
907928364_907928379 23 Left 907928364 1:58975688-58975710 CCTCCCAAAGACCCCACCTCCTG No data
Right 907928379 1:58975734-58975756 TTTAACACATGGATTTTGGAGGG No data
907928364_907928377 19 Left 907928364 1:58975688-58975710 CCTCCCAAAGACCCCACCTCCTG No data
Right 907928377 1:58975730-58975752 AGGTTTTAACACATGGATTTTGG No data
907928364_907928376 12 Left 907928364 1:58975688-58975710 CCTCCCAAAGACCCCACCTCCTG No data
Right 907928376 1:58975723-58975745 TGGAGTTAGGTTTTAACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907928364 Original CRISPR CAGGAGGTGGGGTCTTTGGG AGG (reversed) Intergenic
No off target data available for this crispr