ID: 907928367

View in Genome Browser
Species Human (GRCh38)
Location 1:58975699-58975721
Sequence GGTAATGGTATCAGGAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2931
Summary {0: 4, 1: 30, 2: 220, 3: 762, 4: 1915}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907928367_907928378 11 Left 907928367 1:58975699-58975721 CCCCACCTCCTGATACCATTACC 0: 4
1: 30
2: 220
3: 762
4: 1915
Right 907928378 1:58975733-58975755 TTTTAACACATGGATTTTGGAGG No data
907928367_907928377 8 Left 907928367 1:58975699-58975721 CCCCACCTCCTGATACCATTACC 0: 4
1: 30
2: 220
3: 762
4: 1915
Right 907928377 1:58975730-58975752 AGGTTTTAACACATGGATTTTGG No data
907928367_907928376 1 Left 907928367 1:58975699-58975721 CCCCACCTCCTGATACCATTACC 0: 4
1: 30
2: 220
3: 762
4: 1915
Right 907928376 1:58975723-58975745 TGGAGTTAGGTTTTAACACATGG No data
907928367_907928379 12 Left 907928367 1:58975699-58975721 CCCCACCTCCTGATACCATTACC 0: 4
1: 30
2: 220
3: 762
4: 1915
Right 907928379 1:58975734-58975756 TTTAACACATGGATTTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907928367 Original CRISPR GGTAATGGTATCAGGAGGTG GGG (reversed) Intergenic
Too many off-targets to display for this crispr