ID: 907928368

View in Genome Browser
Species Human (GRCh38)
Location 1:58975700-58975722
Sequence AGGTAATGGTATCAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3371
Summary {0: 3, 1: 34, 2: 216, 3: 861, 4: 2257}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907928368_907928378 10 Left 907928368 1:58975700-58975722 CCCACCTCCTGATACCATTACCT 0: 3
1: 34
2: 216
3: 861
4: 2257
Right 907928378 1:58975733-58975755 TTTTAACACATGGATTTTGGAGG No data
907928368_907928379 11 Left 907928368 1:58975700-58975722 CCCACCTCCTGATACCATTACCT 0: 3
1: 34
2: 216
3: 861
4: 2257
Right 907928379 1:58975734-58975756 TTTAACACATGGATTTTGGAGGG No data
907928368_907928377 7 Left 907928368 1:58975700-58975722 CCCACCTCCTGATACCATTACCT 0: 3
1: 34
2: 216
3: 861
4: 2257
Right 907928377 1:58975730-58975752 AGGTTTTAACACATGGATTTTGG No data
907928368_907928376 0 Left 907928368 1:58975700-58975722 CCCACCTCCTGATACCATTACCT 0: 3
1: 34
2: 216
3: 861
4: 2257
Right 907928376 1:58975723-58975745 TGGAGTTAGGTTTTAACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907928368 Original CRISPR AGGTAATGGTATCAGGAGGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr