ID: 907928369

View in Genome Browser
Species Human (GRCh38)
Location 1:58975701-58975723
Sequence AAGGTAATGGTATCAGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2950
Summary {0: 3, 1: 25, 2: 222, 3: 785, 4: 1915}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907928369_907928377 6 Left 907928369 1:58975701-58975723 CCACCTCCTGATACCATTACCTT 0: 3
1: 25
2: 222
3: 785
4: 1915
Right 907928377 1:58975730-58975752 AGGTTTTAACACATGGATTTTGG No data
907928369_907928378 9 Left 907928369 1:58975701-58975723 CCACCTCCTGATACCATTACCTT 0: 3
1: 25
2: 222
3: 785
4: 1915
Right 907928378 1:58975733-58975755 TTTTAACACATGGATTTTGGAGG No data
907928369_907928376 -1 Left 907928369 1:58975701-58975723 CCACCTCCTGATACCATTACCTT 0: 3
1: 25
2: 222
3: 785
4: 1915
Right 907928376 1:58975723-58975745 TGGAGTTAGGTTTTAACACATGG No data
907928369_907928379 10 Left 907928369 1:58975701-58975723 CCACCTCCTGATACCATTACCTT 0: 3
1: 25
2: 222
3: 785
4: 1915
Right 907928379 1:58975734-58975756 TTTAACACATGGATTTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907928369 Original CRISPR AAGGTAATGGTATCAGGAGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr