ID: 907928371

View in Genome Browser
Species Human (GRCh38)
Location 1:58975704-58975726
Sequence TCCAAGGTAATGGTATCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907928371_907928377 3 Left 907928371 1:58975704-58975726 CCTCCTGATACCATTACCTTGGA No data
Right 907928377 1:58975730-58975752 AGGTTTTAACACATGGATTTTGG No data
907928371_907928379 7 Left 907928371 1:58975704-58975726 CCTCCTGATACCATTACCTTGGA No data
Right 907928379 1:58975734-58975756 TTTAACACATGGATTTTGGAGGG No data
907928371_907928378 6 Left 907928371 1:58975704-58975726 CCTCCTGATACCATTACCTTGGA No data
Right 907928378 1:58975733-58975755 TTTTAACACATGGATTTTGGAGG No data
907928371_907928376 -4 Left 907928371 1:58975704-58975726 CCTCCTGATACCATTACCTTGGA No data
Right 907928376 1:58975723-58975745 TGGAGTTAGGTTTTAACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907928371 Original CRISPR TCCAAGGTAATGGTATCAGG AGG (reversed) Intergenic
No off target data available for this crispr