ID: 907928374

View in Genome Browser
Species Human (GRCh38)
Location 1:58975714-58975736
Sequence AAAACCTAACTCCAAGGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907928374_907928378 -4 Left 907928374 1:58975714-58975736 CCATTACCTTGGAGTTAGGTTTT No data
Right 907928378 1:58975733-58975755 TTTTAACACATGGATTTTGGAGG No data
907928374_907928379 -3 Left 907928374 1:58975714-58975736 CCATTACCTTGGAGTTAGGTTTT No data
Right 907928379 1:58975734-58975756 TTTAACACATGGATTTTGGAGGG No data
907928374_907928377 -7 Left 907928374 1:58975714-58975736 CCATTACCTTGGAGTTAGGTTTT No data
Right 907928377 1:58975730-58975752 AGGTTTTAACACATGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907928374 Original CRISPR AAAACCTAACTCCAAGGTAA TGG (reversed) Intergenic
No off target data available for this crispr