ID: 907928376

View in Genome Browser
Species Human (GRCh38)
Location 1:58975723-58975745
Sequence TGGAGTTAGGTTTTAACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907928371_907928376 -4 Left 907928371 1:58975704-58975726 CCTCCTGATACCATTACCTTGGA No data
Right 907928376 1:58975723-58975745 TGGAGTTAGGTTTTAACACATGG No data
907928372_907928376 -7 Left 907928372 1:58975707-58975729 CCTGATACCATTACCTTGGAGTT No data
Right 907928376 1:58975723-58975745 TGGAGTTAGGTTTTAACACATGG No data
907928367_907928376 1 Left 907928367 1:58975699-58975721 CCCCACCTCCTGATACCATTACC 0: 4
1: 30
2: 220
3: 762
4: 1915
Right 907928376 1:58975723-58975745 TGGAGTTAGGTTTTAACACATGG No data
907928362_907928376 28 Left 907928362 1:58975672-58975694 CCTCTTGACCTAACTACCTCCCA No data
Right 907928376 1:58975723-58975745 TGGAGTTAGGTTTTAACACATGG No data
907928365_907928376 9 Left 907928365 1:58975691-58975713 CCCAAAGACCCCACCTCCTGATA No data
Right 907928376 1:58975723-58975745 TGGAGTTAGGTTTTAACACATGG No data
907928369_907928376 -1 Left 907928369 1:58975701-58975723 CCACCTCCTGATACCATTACCTT 0: 3
1: 25
2: 222
3: 785
4: 1915
Right 907928376 1:58975723-58975745 TGGAGTTAGGTTTTAACACATGG No data
907928363_907928376 20 Left 907928363 1:58975680-58975702 CCTAACTACCTCCCAAAGACCCC No data
Right 907928376 1:58975723-58975745 TGGAGTTAGGTTTTAACACATGG No data
907928364_907928376 12 Left 907928364 1:58975688-58975710 CCTCCCAAAGACCCCACCTCCTG No data
Right 907928376 1:58975723-58975745 TGGAGTTAGGTTTTAACACATGG No data
907928361_907928376 29 Left 907928361 1:58975671-58975693 CCCTCTTGACCTAACTACCTCCC No data
Right 907928376 1:58975723-58975745 TGGAGTTAGGTTTTAACACATGG No data
907928366_907928376 8 Left 907928366 1:58975692-58975714 CCAAAGACCCCACCTCCTGATAC No data
Right 907928376 1:58975723-58975745 TGGAGTTAGGTTTTAACACATGG No data
907928368_907928376 0 Left 907928368 1:58975700-58975722 CCCACCTCCTGATACCATTACCT 0: 3
1: 34
2: 216
3: 861
4: 2257
Right 907928376 1:58975723-58975745 TGGAGTTAGGTTTTAACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907928376 Original CRISPR TGGAGTTAGGTTTTAACACA TGG Intergenic
No off target data available for this crispr