ID: 907928378

View in Genome Browser
Species Human (GRCh38)
Location 1:58975733-58975755
Sequence TTTTAACACATGGATTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907928364_907928378 22 Left 907928364 1:58975688-58975710 CCTCCCAAAGACCCCACCTCCTG No data
Right 907928378 1:58975733-58975755 TTTTAACACATGGATTTTGGAGG No data
907928368_907928378 10 Left 907928368 1:58975700-58975722 CCCACCTCCTGATACCATTACCT 0: 3
1: 34
2: 216
3: 861
4: 2257
Right 907928378 1:58975733-58975755 TTTTAACACATGGATTTTGGAGG No data
907928372_907928378 3 Left 907928372 1:58975707-58975729 CCTGATACCATTACCTTGGAGTT No data
Right 907928378 1:58975733-58975755 TTTTAACACATGGATTTTGGAGG No data
907928365_907928378 19 Left 907928365 1:58975691-58975713 CCCAAAGACCCCACCTCCTGATA No data
Right 907928378 1:58975733-58975755 TTTTAACACATGGATTTTGGAGG No data
907928375_907928378 -10 Left 907928375 1:58975720-58975742 CCTTGGAGTTAGGTTTTAACACA No data
Right 907928378 1:58975733-58975755 TTTTAACACATGGATTTTGGAGG No data
907928363_907928378 30 Left 907928363 1:58975680-58975702 CCTAACTACCTCCCAAAGACCCC No data
Right 907928378 1:58975733-58975755 TTTTAACACATGGATTTTGGAGG No data
907928374_907928378 -4 Left 907928374 1:58975714-58975736 CCATTACCTTGGAGTTAGGTTTT No data
Right 907928378 1:58975733-58975755 TTTTAACACATGGATTTTGGAGG No data
907928367_907928378 11 Left 907928367 1:58975699-58975721 CCCCACCTCCTGATACCATTACC 0: 4
1: 30
2: 220
3: 762
4: 1915
Right 907928378 1:58975733-58975755 TTTTAACACATGGATTTTGGAGG No data
907928366_907928378 18 Left 907928366 1:58975692-58975714 CCAAAGACCCCACCTCCTGATAC No data
Right 907928378 1:58975733-58975755 TTTTAACACATGGATTTTGGAGG No data
907928371_907928378 6 Left 907928371 1:58975704-58975726 CCTCCTGATACCATTACCTTGGA No data
Right 907928378 1:58975733-58975755 TTTTAACACATGGATTTTGGAGG No data
907928369_907928378 9 Left 907928369 1:58975701-58975723 CCACCTCCTGATACCATTACCTT 0: 3
1: 25
2: 222
3: 785
4: 1915
Right 907928378 1:58975733-58975755 TTTTAACACATGGATTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907928378 Original CRISPR TTTTAACACATGGATTTTGG AGG Intergenic
No off target data available for this crispr