ID: 907928633

View in Genome Browser
Species Human (GRCh38)
Location 1:58978536-58978558
Sequence CTCTGTGCTCAGAGGAGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907928633_907928637 6 Left 907928633 1:58978536-58978558 CCTTACCTCCTCTGAGCACAGAG No data
Right 907928637 1:58978565-58978587 TTGATCCTCAAGATTCAATGTGG No data
907928633_907928639 18 Left 907928633 1:58978536-58978558 CCTTACCTCCTCTGAGCACAGAG No data
Right 907928639 1:58978577-58978599 ATTCAATGTGGATCTTCATCTGG No data
907928633_907928640 19 Left 907928633 1:58978536-58978558 CCTTACCTCCTCTGAGCACAGAG No data
Right 907928640 1:58978578-58978600 TTCAATGTGGATCTTCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907928633 Original CRISPR CTCTGTGCTCAGAGGAGGTA AGG (reversed) Intergenic
No off target data available for this crispr