ID: 907929818

View in Genome Browser
Species Human (GRCh38)
Location 1:58988928-58988950
Sequence CAAAGGGAACAGCATGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907929818_907929827 27 Left 907929818 1:58988928-58988950 CCTGGGACATGCTGTTCCCTTTG No data
Right 907929827 1:58988978-58989000 CCATTTCATCCTTAAGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907929818 Original CRISPR CAAAGGGAACAGCATGTCCC AGG (reversed) Intergenic
No off target data available for this crispr