ID: 907929827

View in Genome Browser
Species Human (GRCh38)
Location 1:58988978-58989000
Sequence CCATTTCATCCTTAAGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907929819_907929827 11 Left 907929819 1:58988944-58988966 CCCTTTGCCTGAAATGCCATCCT No data
Right 907929827 1:58988978-58989000 CCATTTCATCCTTAAGTCTCAGG No data
907929818_907929827 27 Left 907929818 1:58988928-58988950 CCTGGGACATGCTGTTCCCTTTG No data
Right 907929827 1:58988978-58989000 CCATTTCATCCTTAAGTCTCAGG No data
907929822_907929827 -5 Left 907929822 1:58988960-58988982 CCATCCTCCTCACTCCATCCATT No data
Right 907929827 1:58988978-58989000 CCATTTCATCCTTAAGTCTCAGG No data
907929823_907929827 -9 Left 907929823 1:58988964-58988986 CCTCCTCACTCCATCCATTTCAT No data
Right 907929827 1:58988978-58989000 CCATTTCATCCTTAAGTCTCAGG No data
907929821_907929827 4 Left 907929821 1:58988951-58988973 CCTGAAATGCCATCCTCCTCACT No data
Right 907929827 1:58988978-58989000 CCATTTCATCCTTAAGTCTCAGG No data
907929820_907929827 10 Left 907929820 1:58988945-58988967 CCTTTGCCTGAAATGCCATCCTC No data
Right 907929827 1:58988978-58989000 CCATTTCATCCTTAAGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907929827 Original CRISPR CCATTTCATCCTTAAGTCTC AGG Intergenic
No off target data available for this crispr