ID: 907932723

View in Genome Browser
Species Human (GRCh38)
Location 1:59015528-59015550
Sequence CTCTTGAAACAGGCTCAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907932723_907932734 23 Left 907932723 1:59015528-59015550 CCTTACTGAGCCTGTTTCAAGAG No data
Right 907932734 1:59015574-59015596 TGGTGATGAGGGTGAACACATGG No data
907932723_907932730 3 Left 907932723 1:59015528-59015550 CCTTACTGAGCCTGTTTCAAGAG No data
Right 907932730 1:59015554-59015576 CCCATGTGGGGATGTGCTCGTGG No data
907932723_907932732 11 Left 907932723 1:59015528-59015550 CCTTACTGAGCCTGTTTCAAGAG No data
Right 907932732 1:59015562-59015584 GGGATGTGCTCGTGGTGATGAGG No data
907932723_907932728 -9 Left 907932723 1:59015528-59015550 CCTTACTGAGCCTGTTTCAAGAG No data
Right 907932728 1:59015542-59015564 TTTCAAGAGAGGCCCATGTGGGG No data
907932723_907932733 12 Left 907932723 1:59015528-59015550 CCTTACTGAGCCTGTTTCAAGAG No data
Right 907932733 1:59015563-59015585 GGATGTGCTCGTGGTGATGAGGG No data
907932723_907932727 -10 Left 907932723 1:59015528-59015550 CCTTACTGAGCCTGTTTCAAGAG No data
Right 907932727 1:59015541-59015563 GTTTCAAGAGAGGCCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907932723 Original CRISPR CTCTTGAAACAGGCTCAGTA AGG (reversed) Intergenic
No off target data available for this crispr